Ocaso en Barnaul

 

CAPÍTULO I

¡Siento que mi cerebro es una bomba, a toda hora del día y de la noche! ¡Quiere estallar, quiere estallar! El cerebro del hombre necesita estallar, aun cuando destruya el Universo.

Así nos habló un novelista del siglo XIX por boca de uno de sus personajes, y la profecía parece haberse cumplido. El hombre era su propio dios, el hombre creó sus propios dioses, pero pronto perdió el control sobre las fuerzas desatadas y sucumbió a sus consecuencias.

El hombre cometió un error hace seis siglos; hasta ahora nunca supimos cuál y, al querer conocerlo, hemos repetido el fatal paso, ignorantes de su alcance.

No importa mi nombre. En realidad es posible que ya nada tenga importancia. Sin embargo una última brizna de vanidad humana, un resto final de ese espíritu de conservación que siempre pugna por legar al futuro una minúscula porción de nuestra identidad, me impulsa a dejar aquí reflejada la autoría de este texto. Me llamo Vadik Magadan y soy uno de los últimos habitantes del planeta Marte.

Hasta hace poco vivía en la ciudad de Altay, en el Hemisferio Schiparelli, cerca del Mar Helado. Tiempo atrás ocho millones de seres humanos poblábamos los litorales de los océanos de Marte. Ahora me oculto en las galerías de las antiguas minas de Barnaul. Apenas quedamos unos miles, desorientados, agonizantes, sin futuro. Pero la esperanza es un extraña ilusión: quizá no seamos los últimos supervivientes; tal vez no terminemos siendo arrasados por nuestra propia osadía.

Toda historia debe tener un comienzo, sin embargo, en ocasiones, resulta complicado determinar la causa primera del posterior devenir de los acontecimientos. En el año 2032 la Colonia Olimpo de Marte inició su vida como organismo social autónomo. Fueron ocho los pioneros, cinco mujeres y tres hombres. Un año antes habían emprendido un viaje sin retorno al Planeta Rojo: cuando abordaron el gigantesco cohete Saturno VII eran conscientes de que nunca más volverían a respirar los olores de la Tierra, de que nunca más disfrutarían del aire libre sobre la superficie de un planeta. Toneladas de materiales y maquinaria enviados en los años anteriores sirvieron de soporte vital a aquellos aventureros durante sus primeros años en el inhóspito mundo que debían conquistar. Los avances se fueron produciendo año tras año, mínimas parcelas que suponían triunfos inmensos. Nuevos módulos de investigación, nuevas edificaciones industriales, prospecciones mineras. Los primeros niños venidos a la luz en el nuevo mundo. En el año 2060 la segunda generación nacida en Marte daba sus primeros e inseguros pasos sobre las rojas arenas del planeta.

Este mismo año Fobos y Deimos dejaron de ser los hijos de Marte y de surcar los cielos nocturnos y descendieron de su reino para instalarse en nuestros corazones, atenazándolos con el miedo y la desazón. En 2060 se interrumpieron las comunicaciones con la Tierra. Ninguna nave volvió a orbitar la rosada bóveda celeste de aquel hogar al otro extremo del Sistema Solar. Para entonces la Colonia ya era autosuficiente y pudo continuar su desarrollo. Fueron seis siglos de lucha y recompensa, de tragedias y alegrías. También fueron seis siglos de angustia durante los que jamás nos olvidamos de aquel punto luminoso que vagaba por el espacio, en silencio, pleno de misterio; siempre permanecería en nuestra memoria. Y siempre sería nuestro destino.

Yo he estado allí. He visto lo que sucedió y conozco el error que cometimos. Nuestra soberbia nos perdió hace seis siglos y, tal vez, nos haya perdido de nuevo. Soberbia por suponer que éramos la primera especie inteligente que había surgido sobre la Tierra. Soberbia por pensar que seríamos capaces de manipular el Tiempo.

Después de seiscientos años de avance en solitario, la civilización humana en Marte se encontraba por primera vez en condiciones de lanzarse al espacio. No hubo dudas ni discusiones: la primera expedición partiría rumbo a la Tierra. Yo iba en aquella nave. Yo fui el primero que supo que los radiotelescopios de la región de Oxie Plaus y de la Sima Candor habían comenzado a detectar señales de radio con origen en el planeta azul hacia el que nos dirigíamos.

CAPÍTULO II

Lusma Usaran, evolucionista que fue de Altay, siempre me acusaba de ser dolorosamente metódico y exasperadamente racional. Quizá tuviera razón. Aquella mañana, víspera del viaje, y mientras cucharilleaba el café decidí serlo por última vez, al menos conscientemente. Me hice con uno de aquellos viejos cuadernos de notas, con hojas amarillentas que tanto me gustaban. Mi última compañera, Destra, los detestaba:

“Un científico de primera línea como tú no se puede permitir el lujo de utilizar semejante reliquia. Usa el fonostrón como todo el mundo”.

Yo guardaba celosamente los últimos ejemplares y sólo los utilizaba para anotar algo verdaderamente importante y que necesitara guardar. Y ésto lo era. Me dispuse a recordar cronológicamente los acontecimientos importantes de mis casi 646 años de vida y anoté lo siguiente:

“Minas de Barnaul s VI mes octavo de la cuaternaria de Deimos dia 21; 8:46h

Situación: Expedición a la tierra. Dos naves estelares de 15 Megatrons, velocidad máxima 0,9c. Dirijo la expedición con plenos poderes.

Objetivo: Recuperar la secuencia del ADN del virus sintético Luzbel.

Antecedentes pertinentes:

sI 5D-16-La ultima transmisión desde la tierra coincidió con una señal nuclear inconfundible

sI 3F-23-Reunión de los 650 miembros del Comité Ejecutivo de científicos.(sI)

Decisiones: Adaptar la evolución de la raza humana del planeta hacia formas menos autodestructivas. Alargar las funciones operativas del Gabinete de crisis formado por 45 miembros para monitorizar la evolución de al menos 50 generaciones. Nombrar Director del Gabinete a Vadik Magadan y Secretario Ejecutivo a Nemos Tolstar.

sVI 2F-02 Epidemia vírica retardada. Produce la muerte del individuo en 8-12 días por deshidratación. Mas virulenta en las cúpulas roja del Gabinete y Dorada, residencia de los técnicos del proyecto de vuelos estelares.

sVI 3F-03 Abandono de las cúpulas superficiales hacia las zonas subsuperficiales con una presión menos favorable al desarrollo del virus.

sVI 4F-32 Se identifica el virus: es sintético de la familia de lo coronavirus. No se puede descifrar su secuencia de ADN por disponer de un apantallamiento genómico.

sVI 8D-12 Botadura de la primera nave estelar de la Colonia. Durante el vuelo de prueba, Nemos Tolstar y 5 colaboradores emprenden viaje no autorizado en dirección hacia el cuadrante 346-A correspondiente, en ese instante a la posición de la tierra.

sVI 8D-15 Se termina el ajuste de las últimas piezas de dos nuevas naves. Se proyecta el viaje hacia la Tierra.

Apuntes técnicos:

El Sistema de propulsión y navegación de las naves estelares de la Colonia: está basado en el principio de incertidumbre:

∆x∆y ≥ h/2

Donde ∆x, incertidumbre en la medida de la posición; ∆p, incertidumbre en la medida del impulso; para la energía, E, y el tiempo, t, se tiene ∆E ∆t ≥ h/2π ; en ambas relaciones el límite de precisión posible viene dado por la constante de Planck, h.
Desarrollo:

V.M.”

El café se había quedado frío pero mi mente estaba en paz. Por fin sabía irremediablemente como debía proceder.

CAPÍTULO III

Esto propendía en pensar Vadik mientras sus ojos, que retenían todavía el reflejo juguetón y multicolor de las sinusoides entrecruzándose en el pequeño visor, estaban cansados de observar la agreste vida de la que habían sido testigos durante varios cientos de años, sin apenas descanso para poder apreciar y ver crecer el espíritu en aquellas nuevas latitudes; en el pasado eón se habían roto amarras con el planeta Tierra lo que resultó ser un aciago presagio de la dura vida en los territorios de Marte ya sin el oxígeno liberador de la atmósfera natal.

“Vadik descansa lo peor aún no ha llegado” susurrábale una voz maternalmente comprensiva en el interior de su alma, alma que a pesar de las penurias constantes de los últimos sextones era digna continuadora de la búsqueda espiritual del hombre apesadumbrado estirpe de filósofos, anarcas, poetas, artistas de la emboscadura y, cómo no, canes metafísicos de diverso pelaje. Su trabajo de liderazgo en la gestión científica y política de la comunidad le dejaba escaso tiempo mientras sus congéneres descansaban – no había período diurno tal como en la lejana Tierra se conocía, en aquella noche perpetua, salvo los reflejos cálidos de las dos lunas de Marte vivificantes y adormecedores a un tiempo- para el fluir incesante de todo nadador metafísico metido de hoz y coz en el perpetuo deambular por los arrabales del ser. La larga historia del pasado humano que le precedía parecía una bagatela al lado de lo innominado que estaba por venir mas continuaba abierto el juego de la vida y seguía el martilleo contumaz de aquellos párrafos en su cabeza febril :

“Por eso se encuentra en el fragmento citado la pregunta: «¿No erramos a través de una nada infinita?». La fórmula «Dios ha muerto» comprende la constatación de que esa nada se extiende. Nada significa aquí ausencia de mundo suprasensible y vinculante. El nihilismo, «el más inquietante de todos los huéspedes», se encuentra ante la puerta.”

Resuena en el alma de Vadik otra vez y más hondo : “Dios ha muerto” ... en un confín inalcanzable, un tronar de algo pesado que se cierra al fondo y abajo. Más adelante, en el texto legado por Martín, otro fogonazo, otro bisbiseo de la pregunta intemporal que trata de esclarecer la profunda sima del sentido:

“Pero los valores supremos ya se desvalorizan por el hecho de que va penetrando la idea de que el mundo ideal no puede llegar a realizarse nunca dentro del mundo real. El carácter vinculante de los valores supremos empieza a vacilar. Surge la pregunta: ¿para qué esos valores supremos si no son capaces de garantizar los caminos y medios para una realización efectiva de las metas planteadas en ellos?”

Una sola convicción se salvó de aquella noche insomne trufada de sueños inexplicables previa a la expedición: debía cambiar la oscuridad interior por algo valioso y duradero.

Habían pasado tres horas desde el meridiano solar y como todas las jornadas con la indefectibilidad debida y en esta latitud del espacio estelar, Fobos y Deimos podían observarse allá en la inmensidad transformados en dos gigantescas esferas de un vivo color naranja. La visión de ese naranja puro no era a través de ningún ventanal estanco a cielo abierto ni objeto translúcido de parecidas características sino que se trataba de la imagen tridimensional tomada por un telescopio isobárico que una pantalla de grandes dimensiones mostraba para regocijo de aquellos humanos que vivían enterrados en vida. Sí enterrados en vida por causa del virus invasor que angustiaba a los supervivientes los cuales denodadamente se protegían en la última y extensa ciudadela subterránea de Barnaul.

La presente jornada era decisiva para el futuro de la Colonia. Tolstar y sus acompañantes abusando de los últimos recursos de Barnaul habían viajado hacia el cuadrante donde debía encontrarse la Madre Tierra. Ninguna comunicación se había establecido con la nave nodriza de Nemos pero se tenía la esperanza que con sus aventajados conocimientos en genética y el material electrónico que había ingresado en la nave poco antes de partir, algún remedio buscara a aquel peligro inminente que quizá sentenciara la vida humana en el Universo. Tal vez la respuesta a la mortandad actual estuviera en el origen espacio-temporal, en el pretérito inmediato – esto es hace seiscientos años - de la raza humana que hollaba el azulado planeta tierra.

No obstante, el comandante Magadan, que a tal grado había llegado tras enteros siglos dedicados a los viajes científico-militares por el ancho Universo, esperaba circunspecto, algo intranquilo, ojeroso y afiebrado en la antecámara de mando en una de las dos naves investidas con el raro orgullo de poder enmendar el curso de la historia de la raza humana sobre Marte. El rumbo era indefinido y el objetivo no menos indefinido, había una voluntad de salvación para con los millares de seres que quedaban allí abajo adocenados por el miedo. Sí, era la esperanza de unos seres entristecidos ante futuro incierto.

Las pantallas de combustión, en medio de un fragor estruendoso, poníanse al rojo vivo mientras la tripulación nerviosa ante lo desconocido de la expedición tomaba sus puestos para el despegue. Magadan jugueteaba en su mano derecha con una pequeña bola de cristal azul, recuerdo donado generación tras generación por sus antepasados. Era de buen augurio y siempre lo tranquilizaba en momentos de tensión. El galimatías técnico propio del despegue pasó sin incidentes, como un fulgor atronador digno de esperanza. Las aeronaves remontaron la Sima Norte, cuya intrigante oscuridad parecía más negra ahora y sólo las naves, en una fracción de segundo dentro del devenir infinito, iluminaban la cavidad vertical mostrando retazos de esplendores pasados. El sellado de las compuertas y la estricta comprobación final mediante sónares de partículas garantizaba que el coronavirus no se había infiltrado en las dos naves interestelares.

CAPÍTULO IV

Vadik Magadan miraba con suma atención la pantalla del monitor que transmitía las imágenes obtenidas por el visor panorámico de rasante de la nave. En ella observó la inquietante abertura de la boca del abismo de la sima, insinuada por la luz radiante que proyectaban en la superficie las estelas luminiscentes provenientes de los motores de propulsión. No pudo evitar la sensación de náusea que le producían las situaciones de incertidumbre no calculada. Conocía muy bien este estado de estremecimiento enfermizo, inherente a la sicología de las personas con marcada tendencia al razonamiento lógico de los fenómenos, ante la eventualidad de un hecho fortuito o la presunción de un misterio inescrutable. No en vano, él había comandado cientos de misiones espaciales. Sabía que toda actividad del ser humano está proyectada desde un presupuesto temporal, que era el que determinaba la concreción factual de la misma. Y esta contextura antero-posterior de la praxis humana es la que posibilita la previsión incluso de la variable “incertidumbre”.

“Somos seres en el mundo” solía decir con frecuencia, “seres arrojados a la existencia” “Lo único cierto y seguro que cabe esperar es la muerte”concluía en tono lapidario.

La muerte es el último eslabón de la cadena de la vida de cada individuo, la expresión definitiva de todos y cada uno de los proyectos de humanidad individual. Cada vez que muere una persona, la definición misma de “humanidad” adquiere un nuevo matiz. Pero, ¿qué ocurriría si desapareciese hasta el último ser humano?

El solo hecho de pensar en esta posibilidad le revolvía el estómago. Y era esto, precisamente, lo que estaba en juego: la extinción de la especie humana en Marte. Más aún, cuando pensaba en la improbabilidad, casi segura, de vida humana en el planeta madre o en cualquier otra colonia interplanetaria.

Él era un luchador incansable, y se crecía ante las adversidades. Pero el reto que debía afrontar sobrepasaba los límites de la esperanza.
Era consciente de la doble responsabilidad que había asumido. Por un lado, debía comandar con acierto la expedición que ya se dirigía a la Tierra y, por otro, y la primordial, llegar a tiempo para salvar a los desvalidos congéneres que deberían permanecer a la espera en las catacumbas de Barnaul y que dependían única y exclusivamente del éxito de la misma.

La nave se alejó de la superficie marciana, y el haz de luz que proyectaba se diluyó en una lluvia de minúsculas lumbreras espaciales. Al mismo tiempo, la tenebrosa boca abismal desapareció de la pantalla del monitor, y con ella su desasosiego.

La pequeña bola azul de cristal brillaba esplendente en una cavidad de la mesa de mando. En ella se reflejaban las lentejas luminosas de la botonadura del panel de amartizaje. Vadik Magadan la miraba con una fijación inconsciente. Cuando volaba, La solía dejar allí, para tener siempre presente su origen, y quizá ahora también su destino final.

La contemplación de su talismán de la suerte le produjo una sensación de seguridad, probablemente supersticiosa, que le sumió en un estado de lasitud ataráxica. “La suerte está echada” pensó, dejándose llevar por el fulgor premonitorio del brillo del talismán.

Y, como si de una bola de cristal de arte adivinatoria se tratara, se sumergió en la entraña del misterio de un sueño oracular.

Comenzó a ver en el cristal azul las imágenes del sueño que le había contado su hija tres días antes de la partida de la expedición.

Ingrida Safo -que así se llamaba la niña, fruto de su emparejamiento con Destra- tenía fama de visionaria y, a pesar de su corta edad, se había ganado el respeto de los habitantes de la comunidad de Barnaul, por sus revelaciones oníricas.

En una ocasión soñó que a su padre se le caía al suelo la bola azul de cristal, que por aquel entonces guardaba en el olvido de un cajón de su mesa de trabajo. Un día la fue a coger y se le resbaló de las manos. Y la bola de cristal se rompió en mil pedazos.

A la mañana siguiente, Ingrida Safo le dijo a su padre que la Tierra podía estallar en una explosión atómica y desintegrarse en el espacio. Y todo por la desidia de quienes tenían en su mano la posibilidad de cuidarla, y no lo hicieron. Después de contarle su sueño, aseveró: “Tú, papá, has de creer que la bola azul de cristal es la Tierra misma, que has de quererla y cuidarla, que es nuestro irrepetible latido primigenio. Mientras esto sea así, aún quedará esperanza”. Vadik Magadan la tomó muy en serio, y desde entonces lleva consigo a todas partes la preciada bola azul.

Las imágenes de la última revelación reflejaban la llegada de un nombre solitario al planeta Tierra.

La nave espacial había aterrizado en la cima de un monte, a unos cincuenta metros de la descomunal cruz que la coronaba. De ella bajó un hombre. En su rostro se apreciaba un gesto de incredulidad, incluso de estupefacción.

El paisaje era desolador, un desierto de tierra, piedras y rocas, recubiertas por un polvo amarillento, el mismo que flotaba en el aire y que le dificultaba sobremanera la respiración.

El hombre caminaba con pasos cortos y lentos, como si fuera un robot con el autogenerador de energía estropeado, y tardó mucho tiempo en acercarse a la cruz. Cuando lo hizo, se sintió verdaderamente pequeño, ante la gigantesca mole de hierro y hormigón. Una vez allí, comprobó que de sus brazos abiertos colgaban unas enormes agujas de hielo, que mostraban una extraña tonalidad purpúrea. ¿Quizá fuera sangre derramada en un antiguo holocausto?

Advirtió también que, al pie de la cruz, había una losa que sobresalía de la superficie. Avanzó hacia ella, hasta que pudo tocarla. Quitó el polvo amarillento que la cubría y descubrió la inscripción que éste escondía: “Monte Esperanza”

Permaneció unos minutos sobrecogido, en un estado de perplejidad que le impedía reaccionar. Al cabo de un rato, no sin dificultad, volvió sobre sus pasos. Y de nuevo ante la cruz, quiso palpar su tronco, sentir la frialdad de la piedra; pero, cuál no sería su sorpresa cuando, al hacerlo, apreció en él unas marcas, que parecían letras grabadas. Las observó con mucha atención, y logró descifrar su mensaje. Rezaba así: “Alejaos de Luzbel”

Ingrida Safo no supo interpretar el sueño; pero, cuando se lo estaba contando a su padre, recordó que al hombre protagonista del mismo se le cayó una bola azul de cristal sobre la losa de piedra.
El agudo pitido del chivato de recepción de ondas ultrasónicas le sustrajo del vientre imaginario de la bola mágica de cristal. Procedía de un lugar desconocido. Quizá fuera la esperada comunicación de Nemos Tolstar...

 

CAPÍTULO V

—A ver Vadik. ¿Estás operativo? ¿O te has vuelto a quedar dormido utilizando tus cuadernos?

—Para ser un traidor y estar expuesto a las más duras sanciones del Comité Central, conservas toda tu petulancia, Nemos.

—No empecemos con las discusiones bizantinas de siempre, creo que el Comité no tendrá tiempo para deleitarse con la visión de mi cabeza en una bandeja. A propósito, ¿te interesa conocer en qué situación se encuentra este planeta?

—Por supuesto, ¿me permites que convoque a los responsables de la expedición e informe al Comité de que hemos establecido contacto contigo.

—Vadik. Entérate primero de cuál es la situación y después reflexiona sobre lo que contarás al Comité. Tienes dos días de aceleración y deceleración para preparar los informes que quieras, pasa a función imagen y permite que no veamos las caras.

¿Dónde estará el jodido portátil?

—¿Tienes problemas Vadik?¿No encuentras el fonostrón? Usa el de sobremesa, calamidad. Desde luego no me extraña que Marte haya llegado a la situación en la que nos encontramos, en manos de semejante conjunto de carcamales.

—Aquí está. ¡Qué buen aspecto tienes Nemos! ¡Cuanto más gratificante es elegir el envejecimiento y la muerte que esta vida artificial de la que gozamos estos carcamales de los que hablas!

—¡Vadik! ¿Qué te pasa ahora? ¿Te ha sentado mal la sesión anual de rejuvenecimiento? Necesitas una ración extra de cobaltoporfirina.

—Perdona, no es nada. Todavía me sorprenden las comunicaciones holográficas.

—Resumiendo. Llegamos a la órbita de la Tierra en sVI 8D – 17 12:21:23, tras un viaje sin incidentes.

Enviamos sondas a las mayores ciudades del planeta y a algunos puntos representativos de los diferentes ecosistemas que conocíamos al abandonar la Tierra.

Como ves, el panorama es desolador y corresponde a lo que podríamos llamar una primavera nuclear: no hay rastro de vida, se han depositado la mayor parte de las partículas sólidas de la atmósfera y los niveles de radiación han bajado a límites razonables, salvo en las zonas próximas a las explosiones nucleares, que pueden evaluarse en 11.300 con un valor de unos 70.000 Megatones.

En sVI 8D 21, se preparan varios equipos robotizados para realizar investigaciones de campo. Aterrizan sin problemas y su informe inicial corrobora los datos recogidos por las sondas, aunque es prematuro emitir juicio alguno, sobre todo porque hemos recogido la siguiente información adicional.

Esto que estás viendo, es un resumen de los informativos de los días anteriores al comienzo del conflicto, existente en un satélite de comunicaciones chino. Sí, ha sido el único que ha conservado energía en las baterías de control remoto de los ordenadores, el resto de los que se ha mantenido en órbita no responde a señales exteriores.

La letra que hemos conseguido poner a estas imágenes es la siguiente: Los responsables del comienzo de este desastre son estos tipos tan feos, cuyo nombre es Mioritas o Moilitas. Son una especie terrestre antediluviana…

—¡Oye Nemos! Me estás tomando el pelo. Lo que has encontrado en ese satélite chino es una película de Godzila.

—Pues ve a por palomitas, Vadik, por que solo es el principio. Como te decía, los Mioritas debieron poblar la tierra durante la era Terciaria, con los dinosaurios, con la diferencia de que su desarrollo tecnológico era enorme.

—¿Y por qué no fueron encontrados restos fósiles de ellos?

—¿Quién dice que no fueron encontrados? Ahí empezó todo. En el 2050 terrestre (sI 18), el gobierno egipcio autorizó las excavaciones bajo la pirámide de Keops, siguiendo las teorías de los arqueólogos de la Universidad de Atapuerca, que pensaban que la cámara mortuoria del faraón, la auténtica, estaría alojada entre las fundaciones de la pirámide.

Lo que descubrieron fue que la pirámide no tenía fundaciones, sino que era la cúspide de un rascacielos de 600 m de altura, alrededor del cual se encontraba una megalópolis.

 

CAPÍTULO VI

—Eso es bastante complicado, y tú mejor que nadie deberías saberlo. – respondió Vadik mientras consultaba su cuaderno de notas- Los dinosaurios se extinguieron en la era Mesozoica tras la caída del meteorito que colisionó con la tierra a finales del cretácico y por tanto no pudieron coexistir con los Mioritas durante el Terciario.

—Discúlpame viejo carcamal, permíteme que matice la información que te dí antes.

—Querrás decir corregir- interrumpió Vadik

—Los que usamos fonostrón no nos equivocamos, más bien sufrimos los errores de percepción de los que usáis libreta. Y Ahora deja que te siga detallando:

Según parece un grupo de geólogos de la Universidad de El Cairo realizó una datación radiométrica sobre unas rocas metamórficas del yacimiento. Los resultados situaron el estrato sobre el que se apoyaba la megalópolis en el Maastrichtiense (cretácico superior), es decir en un intervalo de tiempo entre 71 y 66 millones de años.

—Interesante. ¿Se sabe algo sobre el linaje del cual podrían haber evolucionado? ¿Tal vez algún tipo de reptil o dinosaurio? – preguntó intrigado Vadik

—Mucho me temo que los estudios de anatomía comparada que se realizaron entre los restos fósiles encontrados de los Mioritas y los de las especies contemporáneas, reflejaron tantas diferencias que fue imposible establecer un antecesor común.

—¿Y que hay del parentesco con los mamíferos? – volvió a insistir

—Mi querido Vadik, los mamíferos del mesozoico no pasaban por ser más que unas cuantas especies similares a los ratas. Es imposible que tengan algo que ver los Mioritas

—Esto nos deja un vacío en el registro fósil y en consecuencia en la historia evolutiva de los Mioritas – susurro la mente de Vadik mientras buscaba respuestas en los recovecos de su conocimiento.

—No dispongo de amplificador, o subes el tono o sigues la conversación en morse - Bromeo Nemos para llamar su atención

—Si, si, perdona – y continuo divagando sin repetir la afirmación- Si cogemos como ejemplo el comienzo de la era terciaria cuando los mamíferos comenzaron su diversificación para ir ocupando los nichos ecológicos de los dinosaurios tras su extinción, no encontramos periodos de especiación a las nuevas presiones ambientales inferiores a 200.000 años.

Es más, aún así presentan una similitud del 98% con sus antecesores, por lo que para tener especies tan derivadas que no se las pueda emparentar con ninguna otra se debería necesitar varios millones de años.

—¡Oye! dile a tu holograma que se explique mejor – se desesperó Nemos

—Muy sencillo, no se tarda lo mismo en “evolucionar” de Mamut a Elefante, que en hacerlo de anfibio a reptil.

—Ya, y no tenemos ni un solo resto en el registro fósil del cretácico que nos de una pista de alguno de los antecesores de nuestros Godzilas.

—Efectivamente Nemos ¿a menos que…? – su voz dudo a la vez que sus cejas se arquearon en señal de satisfacción

—Si, afortunadamente hay una respuesta posible:Durante un espacio de tiempo en forma y lugares que tendremos que determinar hubo vida inteligente no terrestre en nuestro olvidado planeta azul.

—Ya, y dices que afortunadamente

—Sí Nemos, tengo una pequeña intuición. Si recuerdas los virus de la familia coronavirus tienen un origen sintético, sin embargo ningún gobierno reconoció haber sido el autor de semejante aberración. Si los Mioritas fueran los portadores tal vez podríamos descifrar la secuencia de ADN, o encontrar anticuerpos que paliaran las consecuencias de su infección.

—¿Quieres decir que podría existir alguna relación entre el desastre terrestre y la epidemia que asola Marte?

—Tal vez. En cualquier caso es demasiado pronto para aventurarse a realizar cualquier tipo de aseveración. Creo que hasta nuestra llegada deberías centrar tus esfuerzos en reunir mas información sobre los siguientes puntos:

Genética de los mioritas y ver hasta que punto es similar a los coronavirus.

Averiguar si se manifiesta en todos los infectados, o por el contrario puede haber portadores sanos.

Si el holocausto fue consecuencia de una guerra contra los Mioritas, ¿qué los devolvió a la vida o a la Tierra?

Y sobre todo de dónde proceden las señales de radio.

  

CAPÍTULO VII

La vida es un asunto complicado de sobrellevar y en sí misma sin demasiado sentido; es un cuento contado por un idiota, lleno de ruido y furia, y que no significa nada. Cuando has acariciado con tus manos más de seiscientos años, esto resulta evidente. Pero nunca estará tan repleta de caos y aleatoriedad como una conversación con Nemos. Nunca sé por qué primero lanza una aseveración contundente para, a continuación, matizarla hasta tal punto que finaliza diciendo exactamente lo contrario de lo que en un inicio planteó. Como acaba de hacer. El problema que siempre ha aquejado al mundo es que los necios y los fanáticos siempre están seguros de sí mismos, mientras que los sabios están llenos de dudas: en presencia de un necio sin fisuras estamos perdidos. Y no sé si Tolstar se ha convertido en un sabio o en un necio. Afortunadamente las bases de datos de nuestras naves replican perfectamente la suma de conocimientos que poseemos en Marte sobre la historia y prehistoria de la Tierra. Supongo que esa ansia de contradicción enfrentada a una paradójica seguridad y la pedantería perpetua de Nemos son un efecto secundario de la ingesta prolongada de la cobaltoporfirina. Combinada con la omnicilina se transforma en la fórmula mágica que nos convierte en seres de una longevidad excepcional.

Y pagamos un peaje por ello, al menos yo lo pago, porque en ocasiones sólo incrementando la dosis de la primera droga soy capaz de sobrellevar los ya innumerables días de mi existencia. Me consta que algo similar les ocurre a todos los miembros del Gabinete de Crisis; algún curioso mecanismo psicológico que nunca hemos sido capaces de determinar hace que la sobredosis de cobaltoporfirina actúe de modo diferente sobre cada uno de nosotros. En mi caso siempre sufro unos vahídos mentales entre místicos y nihilistas, de los cuales ni yo mismo soy capaz de desentrañar su significado. Por fortuna después me sumerjo en una lasitud ataráxica que me hace olvidar tales desasosiegos y que al poco se torna en una leve, pero continuada sensación orgásmica de duración temporal subjetiva infinita.

Pero es momento de regresar a las anotaciones pertinentes para la misión. Misión de vital importancia para la supervivencia de la raza humana; por tanto debo analizar las inconsistencias que he detectado en las informaciones transmitidas por Nemos Tolstar:

Nemos escapó de Marte como un traidor o como un cobarde, no sabría por cual opción inclinarme. Sin embargo ahora se presenta como una avanzadilla de esta expedición, como si su partida extemporánea de nuestro planeta hubiera sido una acción perfectamente lógica. ¿Por qué actuó de esta forma? ¿Cuáles fueron sus motivos?

Sólo un hecho es objetivamente indiscutible: las comunicaciones con la Tierra se extinguieron hace más de seis siglos (las explosiones nucleares masivas están recogidas en nuestros anales de aquella época) y sólo ahora, después de este tiempo, se han reiniciado. Una señal que delata que aún queda vida en el planeta, que solicita, con angustia y de forma reiterada, saber si hay algún otro grupo humano tecnológicamente avanzado en el Universo. Después de la conversación con Nemos, ¿podemos estar seguros de que son seres humanos?

Lo que nunca se reflejó en los anales del Gabinete fueron las causas de aquel holocausto. Y no lo fue porque no lo supimos. Ni lo sabemos aún. Sin embargo ahora Nemos nos habla de una extraña raza del mesozoico y declara haber obtenido toda la información que nos ha transmitido en un satélite chino. Tengo la sospecha de que miente en algo, porque no resulta creíble que unas noticias de tal repercusión no llegaran a Marte en aquellos tiempos. Es posible que lo del satélite no sea más que una cortina de humo de Tolstar. Cuantas más vueltas le doy en mi cabeza al asunto más convencido estoy de que ya ha descubierto las coordenadas de origen de la señal y de que es en ese lugar donde ha obtenido las imágenes que nos ha remitido. De hecho su nave aún invisible para los equipos de rastreo, no podemos triangular todavía su señal, lo cual quiere decir que ya ha situado los satélites estacionarios en órbita en la Tierra y que se aprovecha de ellos para escamotear su situación. Debemos aproximarnos más al planeta para poder localizarle. Pero, siguiendo con la duda razonable que antes planteaba, ¿y si Nemos ha caído en una trampa?

Vuelvo a consultar la base de datos y compruebo que hay una información que sí concuerda de manera tangencial con lo que ha informado Nemos. Es lo siguiente: en 2050 se cerró la ciudad de Gizeh en Egipto al turismo alegando razones de protección de las áreas de interés cultural. Este dato concuerda con el supuesto descubrimiento de la megalópolis a la que hace referencia Tolstar, aunque este dato jamás se llegó a filtrar a la opinión pública. Hubo rumores que hasta Marte llegaron, pero nada tan categórico como lo que, al parecer y de forma tan precisa, presenta el supuesto satélite chino. Las noticias subsiguientes son extrañas, confusas y, en ocasiones contradictorias. La guerra entre Israel y Egipto y la ocupación militar del delta del Nilo por tropas combinadas de la OTAN e Israel podría tener algo que ver con el asunto, aunque no resulta evidente. Los noticiarios sí que reflejan como extraordinario el inmenso despliegue de tropas que se produjo en la zona: casi dos millones de efectivos. Desalojos masivos de ciudadanos egipcios, cierre del Canal de Suez. Bloqueo del Mediterráneo Oriental al tráfico mercante. Todo ello alegando la inestabilidad del régimen islamista de El Cairo y el incremento de actos terroristas por parte de los Hermanos Musulmanes Renacidos. Esto último totalmente incongruente con la realidad de los años anteriores e incluso posteriores a la guerra, en los que la ausencia de noticias en este sentido en la mayoría de las bases de datos es notable.

Un último punto relacionado con todo este misterio. A comienzos de 2060 se produce la aparición de un extraño brote vírico de sintomatología muy parecida a la del que invade Marte. Esta información fue recogida en apenas tres sueltos en diversos periódicos unas semanas antes del holocausto, el 12 de enero de 2060. La noticia me hubiese pasado desapercibida si no hubiera sido porque uno de los brotes se produjo en El Cairo. Una nueva y extraña (o quizá no tanto) coincidencia.

FIN DE LAS ANOTACIONES

Podríamos estar soñando siempre, pero no percibimos estos sueños mientras estamos despiertos, porque la conciencia (como el Sol que oculta las estrellas durante el día) es demasiado brillante para permitir que el inconsciente conserve tamaña definición. Quizá la vida sólo es sueño, sueño ininteligible para la propia mente que lo pare. Así meditaba Vadik cuando su reflexión fue interrumpida por la presencia de uno de los miembros de la tripulación de la nave.

—Comandante Magadan, los púlsares positrónicos de estribor están orientados según sus órdenes, señor.

—Gracias, oficial al-Yakhint.

Vadik permaneció con la mirada perdida durante unos segundos, mientras regresaba de un nuevo periplo por su mundo interior. Debía dejar de tomar droga con fines lúdicos. Cada vez le costaba más trabajo regresar a la realidad. Todavía unos segundos permaneció observando la marcial y apuesta figura del segundo oficial de navegación Warran al-Yakhint. Dos meses ya de navegación desde que abandonaron Barnaul. Dos meses sin Destra. Era una lástima que aquel viaje entrañara tantos peligros. La situación era tan crítica en el planeta perdido en la distancia que el Gabinete decidió que ninguna mujer embarcara en la nave Viking ni en su gemela la Mariner. La procreación y el mantenimiento de una esperanza para la continuidad de la especie aconsejaron tomar aquella decisión, tan contraria al auténtico espíritu de liberalidad que siempre había acompañado a la civilización marciana.

Volvió a mirar con ojos soñadores a Warran. Aquella noche ordenaría reducir la aceleración de la nave a 1/4 g y solicitaría al oficial que acudiera a su camarote con cualquier disculpa. Para ciertos asuntos la ingravidez era un aderezo que mejoraba en grado notable el guiso.

Aún con un hormigueo en los testículos, anuncio de lo que estaba por llegar, se obligó a atender a las palabras al-Yakhint.

—A esta distancia de la Tierra ya es posible comenzar el rastreo que ordenó, señor.

—¿Han detectado los satélites estacionarios?

—Sí, comandante Vadik. Tenía usted razón. El traidor Nemos los ha situado en órbita.

—No emita juicios apresurados, Warran. No sabemos las razones que impulsaron al comandante Tolstar a actuar cómo lo hizo.

—Lo siento, señor. Soy consciente de que ustedes han sido amigos durante cientos de años. Sin embargo, su huida precipitada…

—No lo sé, Warran. Estoy casi seguro de que me mintió varias veces durante la comunicación de ayer, sin embargo sigo pensando que no es un traidor. La falsedad del satélite chino era tan burda que no puedo creer que su intención real fuera engañarme. Además estoy seguro de que hubo alguna poderosa causa que lo impelió abandonar Marte con la Pathfinder.

Al-Yakhint entornó los ojos, pensativo. Vadik se incorporó y puso su mano sobre el hombro del oficial, animándole a explicarse.

—Verá, señor. Mi amigo Emil Salocín viaja como segundo artillero en la nave del comandante Tolstar.

—Un detalle interesante, Warran- comentó Vadik con un tono ambiguo.

—Sí, bueno – continuó el joven oficial turbado y con un sonrojo de intensidad creciente.- El caso es que la noche anterior a la partida de la Pathfinder me puso al corriente de ciertas ideas que bullían en la mente de su comandante. Al parecer Tolstar creía que la epidemia del virus Luzbel no era fruto de la aleatoriedad, de una mutación estocástica de una cepa preexistente en Marte.

—Siga, oficial. Eso que dice es muy interesante.

—En realidad ninguno de los dos hicimos mucho caso del asunto. Creíamos que eran los desvaríos propios del abuso de la cobaltoporfirina.

Warran se interrumpió temiendo haber hablado más de la cuenta. Al fin y al cabo, Magadan, al igual que Nemos, era miembro del Gabinete y a buen seguro la droga también le afectaba de alguna manera.

—Lo siento, señor. No quería decir que…

—No se disculpe, Warran. ¿Qué más le dijo su amigo Emil aquella noche?

—Me habló de las investigaciones que había realizado Tolstar. Insistía en que el nivel de impactos meteoríticos en la región de Tharsis durante las dos semanas previas al inicio de la enfermedad se había incrementado espectacularmente. Había realizado varios análisis de balística gravitacional y…

El fonostrón de comunicaciones con el puente de mando pulsaba con insistencia en demanda de respuesta. Vadik retiró la mano del hombro del oficial y la dirigió hacia el interfono.

—¿Y…?

—Según el comandante Tolstar, el origen de aquella inusual actividad meteorítica se encontraba en la Tierra – concluyó su explicación al-Yakhint.

La figura del primer oficial se materializó en forma de holograma traslúcido y tembloroso en el camarote de Magadan. Se apreciaba una agitación inusual en el puente de mando. Detrás del oficial Jenz Rosen, los timoneles y el oficial de derrota señalaban nerviosos hacia las pantallas de navegación.

—¿Qué sucede, oficial Rosen? – preguntó Vadik, inquieto.

—Señor, el barrido positrónico ha finalizado. Hemos establecido con precisión la distribución de impactos nucleares en el planeta. Y el resultado es extraño.

—No adelante interpretaciones, oficial. Exponga los hechos. Mejor, proyecte la imagen obtenida.

Vadik no pudo evitar un estremecimiento de terror al ver aquel mundo en colores pastel flotando delante de sus ojos. Los resultados de la exploración eran concluyentes y avalaban los datos de Nemos. Exactamente 11.789 explosiones nucleares habían compuesto la orquesta de muerte y destrucción que habían acabado con el planeta madre. Pero lo que le había helado la sangre era la intensidad cromática de algunas zonas del mapa holoproyectado.

—¿Es correcto lo que estoy viendo, Jenz?

—Sí, comandante. Aproximadamente un tercio de las explosiones se produjeron en la zona del delta del Nilo. Como verá hay dos zonas más de intensidad superior a la media: una Escandinavia y otra en la región de Shangai, cada una con un 15% de los impactos.

Era evidente: las casualidades no eran posibles en aquella ocasión. La información que había extraído sobre las regiones en las que se habían producido los brotes víricos en la Tierra coincidía con las zonas de color rojo intenso que flotaban ante sus ojos.

—¿Señor, se encuentra bien?

—No, Jenz, creo que no.

“Todo se acelera, Vadik”, pensó Magadan mientras una sirena comenzaba a atronar toda la nave. No había tenido tiempo de asimilar la noticia y ya los acontecimientos se precipitaban. Acompañado por al-Yakhint corrió hacia el puente.

—Es la nave de Nemos, ¿verdad?

—Sí, comandante – respondió Rosen. – Hemos hallado su posición. Y además hemos detectado el origen de las señales que captamos al partir de Marte.

—No me lo diga. Coinciden las dos.

—Sí y no, comandante. La nave de Tolstar se encuentra en órbita estacionaria sobre Europa. Varias lanzaderas de la Pathfinder han descendido sobre el planeta.

—¿Dónde demonios están?

—En la Península Ibérica, cerca de la antigua capital del estado llamado España… Un momento, señor. Según los registros cartográficos están en una zona denominada Valle de Los Caídos.

—¿Y las señales?

—Fueron enviadas desde un lugar próximo, quizá a unos 50 km. – respondió Rosen.- Los mapas señalan el nombre de Robledo de Chavela. Pero hemos podido discriminar un segundo foco de emisión. La señal está sincronizada con la de Europa, reforzándola, de ahí que no nos hubiéramos percatado hasta ahora de esta duplicidad.

—¡Joder! – masculló entre dientes Magadan. Luego, elevando la voz – Concluya, oficial.

—El segundo foco emisor se localiza en América, en el hemisferio sur, en la zona de Río de Janeiro.

—¡Warran! Pida la información gráfica disponible en las bases de datos sobre esas regiones – ordenó Vadik. Un pálpito premonitorio le susurraba que había una clave oculta en aquellas localizaciones.

—Proyectando, señor.

Allí estaba la confirmación del oráculo. Volvió a su mente el recuerdo del sueño de la pequeña Ingrida: la cruz del onírico Monte Esperanza. En Europa, una enorme cruz se elevaba en la cima de un promontorio en lo que debía ser el llamado Valle de los Caídos. En América, coronando una montaña, una gigantesca figura humana con los brazos abiertos presidía una bahía sobre la que se amontonaba una inmensa ciudad.

Vadik ordenó acelerar la Viking a 2 g. Exhaló un suspiro mezcla de resignación y excitación. El encuentro con Warran al-Yakhint debería posponerse. Pero Nemos estaba por fin a su alcance y, quizá, la posibilidad de desvelar aquel misterio.

Y la Tierra. Tan próxima después de tanto tiempo. Arrasada y transformada en un enigma. Le aterraba la idea de contemplar la desolación de la cuna de que les había acogido alguna vez. Recordó las palabras de un olvidado poeta, veréis llanuras bélicas y páramos de asceta tierra para el águila por donde cruza errante la sombra de Caín. La Historia es una pesadilla de la que el hombre nunca despierta.

CAPÍTULO VIII

En las pantallas de aproximación como un ángel errante se materializó la Pathfinder. Debo reconocer que el brillo azulado que emitía me produjo un escalofrío también azul sólo comparable al que aparece cuando tienes que amenazar a un viejo amigo.

—Compañero Warran prepare las balizas de detección. Lance tres secuenciadas, si tras ninguna de ellas la Pathfinder se posiciona en derrota, levante los muros energéticos y dispare los torpedos de popa a toda potencia.

—Señor, todo eso prácticamente desintegrará la nave- replico Warran, atusándose gentilmente su recia melena rubia.

—Eso, oficial, no es de su incumbencia. Limítese a obedecer.

Soy el mas imbécil de los repugnantes reptiles que se arrastran por las minas de Barnaul y acababa de malograr mi unica puerta al placer. Estaba esféricamente cabreado, no por mi frustración sexual sino por que presentía que no estaba controlando la situación.

—Comandante, acabamos de lanzar la ultima baliza y no hay respuesta de la Pathfinder. Podríamos…

—Ni podríamos, ni potorros. Dispare señor al-Yakhint. Obedezca, coño.

Cuatro torpedos como cuatro jinetes de la Apocalipsis partieron de la toberas de popa de nuestra nave. Sin embargo no hubo encuentro tampoco hubo error en los cálculos, la Pathfinder ya no estaba allí.

—Señor, ¿disparo los de proa? Están preparados.

—No Warran. Mantenga los muros y posicione la nave en espera y espere instrucciones. Me voy a mi cubículo a reflexionar. Se que hay algo que no encaja.

Las cosas siempre pueden ir peor, terminé el ultimo de mis cuadernos mágicos tras la comunicación con Nemos. Tengo que pensar pero me estalla la cabeza, va a explotar.

Una dosis cumplidita de cobaltoporfirina me ayudó a volver a mi estado normal, se había disipado la niebla, podía respirar, podía pensar. Recuperé mis ultimas anotaciones. Piensa Vadik. ¿dónde está Nemos y la Pathfinder?, si el mismo virus que nos está matando en Marte lo sufrieron aquí en la tierra ¿quién hace las señales?, si son humanos habrán encontrado un antídoto pero ¿por qué mandaron el virus a Marte? ¿Qué fuerza telúrica les condujo a destruirse?

Llevaba casi una hora desparramado en el sillón de mi cubículo y no encontraba respuestas. No sé porque me acordé de lo que siempre me decía mi padre: “la clave de todo esta en esencia de la condición humana: la duda, si no hay duda no hay vida”. Por fin algo claro en esta maraña de oscuridad: la duda, el principio de Incertidumbre, la razón de ser de las naves. “Es imposible conocer con certeza y al mismo tiempo la posición y la velocidad de un objeto”.

—Warran, escuche con atención. Como sabe no podemos conocer con precisión la velocidad y la posición de la Pathfinder, por tanto si ahora está parada sobre la Península Ibérica conocemos perfectamente su velocidad relativa, nula, por tanto es imposible conocer su posición y por eso hemos fallado y no la localizamos. El principio de Heisenberg.

 

CAPÍTULO IX

Tras la conexión fonostrónica se sintió bastante débil, y advirtió que las fuerzas le flaqueaban sin razón aparente. Aquella mañana había desayunado su tazón de extracto de cobaltoporfirina como en otras tantas alboradas durante sextones y sextones de aquella vida cuasieterna. No obstante, el alimento no se había asentado en el cuerpo. Mientras mojaba las rebanadas de soja enriquecida en el jugo de extracto del principio eternizante, algo se torció ahí dentro. Ahora en el puente de mando de la nave, en el cubículo del artillero jefe, vacío en este momento por no haberse dado ninguna señal de alarma, echó una cabezada reparadora, y al desperezarse, un quinto de cuarzo-esfera laser más tarde, mientras observaba la inmensa negrura estrellada del universo, volvió aquella imagen que le asaltaba desde hacía meses. Imagen formada durante su búsqueda de largas jornadas en el hipernavegador de la Colonia, intentando explicar esa sensación fiel, lejana y cercana a un tiempo, como por debajo de la piel, subterránea y fiel. La Providencia. Tal era el resultado ignoto del magma mental en progresión al borde de esa sensación de estallido mental más allá de cualquier entendimiento, sí la pobrecita testa casi a punto de estallar. La concreción puntual de ese convencimiento no podría perjudicarlo en este crucial momento de su singladura. Me sigo llamando Nemos y el significado de semejante arrastrarse sideral muta el significado, todo parece haberse transvalorado.

Hace tres sextones que decidí dar respuesta cumplida a mi sentido errante de la existencia, pensaba yo ¿pero como va a morir toda aquella gente aquí arriba ahora que poseemos un medio de vida eterna? Nadie pareció hacerse cargo del problema de forma contundente. En mi interior se iluminaba el problema con clara luz del mediodía. La Madre Tierra atesoraba la clave del asunto vírico y quizá aflorasen respuestas a otras innominados interrogantes que surgieran en el mismo culmen de la misión. No sería capaz de exponer razones fundadas porque quizá al fin y la postre estuviese persiguiendo una oscura intuición.

—Mi comandante, perdone la interrupción, hemos detectado torpedos positrónicos dirigidos a nuestra última localización en el cuadrante omega-veinte latitud cuarenta y tres terráquea – declaró el afable y caribermejo Mayor Mur-Alkami, mano derecha de Tolstar desde tiempo inmemorial. ¿Ha reflexionado sobre los siguientes pasos a dar?

—No demasiado … - contestó de forma automática como un resorte Nemos Tolstar al tiempo que salía de sus ensoñaciones. Algo sí tengo claro, digámoslo así : vienen a por nosotros y debemos continuar con nuestro cometido. Prepare la lanzadera Ramses con todo el material científico y abandonemos la nave de una vez. Volvemos a la Tierra. Si detectan el cuadrante exacto de nuestra nave nodriza deberemos soportar su pérdida, no nos queda más remedio que huir de nuestro tenaz perseguidor.

—Muy bien, mi comandante. Una observación, si se me permite : le noto grisáceo, ¿no habrá vuelto a tener problemas con su desayuno, verdad?

—Algo de ello hay, pero no se preocupe, mi querido Mur-Alkami. Debemos continuar pese a este cuerpo derrengado y …inasequible a los sextones y tal vez … a la soja de Marte.

—¿Doy entonces la orden a toda la tripulación de preparar los equipajes con el equipo de supervivencia molecular?

—Sí, por favor, mi apreciado Mur-Alkami. Nadie debe quedar en la nave… la abandonaremos en órbita fantasma esperando … - y mientras pensaba “que la Providencia la proteja” simplemente su boca exhalaba – que alguien la proteja. Nosotros ya no podemos hacer más. Todo se vuelve incierto ahora que estamos a las puertas del centro del enigma.

El Mayor de la nave con paso lento y como embrujado por la orden recibida, acudió al fonostrón de la cubierta de mando para informar a la tripulación del próximo despegue de Ramses. Su abrigo largo de plexiglás aterciopelado, color azul índigo, le daba cierto aire cómico sólo rebajado por la contundencia de sus palabras ante los tripulantes y sus ademanes pausados. La dependencia del Comandante Tolstar se mezclaba por una predilección infantil y un fervor en la defensa de sus decisiones. Hizo su trabajo y en persona, como tenía por costumbre, acudió al hemiciclo del laboratorio para revisar y comprobar fehacientemente el empaquetado del instrumental.

Llegada la hora, todos se mostraban nerviosos; pero, al mismo tiempo, contentos ante la perspectiva de volver a surcar el cielo azul de la Tierra. La excitación de los miembros de la tripulación se manifestaba en el brillo especial de sus ojos y en las indisimuladas sonrisas que se dibujaban en sus rostros; aunque éstas se tornaron en seriedad casi fúnebre al aparecer el Comandante para pasar revista, ataviado con ropa extraña, aquella que desde hacía seis siglos ningún habitante de Olimpo había podido observar, pues era de otra época y hacía recordar el precedente eón terrestre. Era de tejidos resistentes a la radiación nuclear, color caldera, con correajes de cuero auténtico y yelmo solar metálico con lentes apropiadas para la visión diurna y nocturna en la atmósfera natal.

—Mayor, ¿todo en orden para abandonar la nave?

—Sí mi Comandante, sin novedad- respondió, cuadrándose con arreglo a la actitud marcial de todo militar que se precie.

Nemos Tolstar, como responsable y cabeza visible de la tripulación, fue el último en subir a Ramses; antes de hacerlo, se demoró en la rampa de entrada y volvió la vista atrás, para escudriñar aquel emporio metálico que tal vez con fortuna sobreviviera al lance actual. Con cierta nostalgia, que no podía ocultar, buscó algún resquicio de humanidad en aquellas mamparas, paneles e innumerables lucecillas, algo salvífico y reconfortante. En su fuero interno sintió que la fortaleza de su ánimo no flaqueaba en absoluto. Y de nuevo le asaltó la imagen como una salmodia secreta, aquella que había podido ver en la pantalla del puente de mando repetidas veces, adobo de noches insomnes. En la gran cruz, en el mismo centro de la piel de toro, aguardaba la solución a sus desvelos. Quería ser su descubridor, el primer testigo de una larga saga imperial, de un imperio nuevo y disímil cuyos restos estaban siendo arrinconados en la ciudadela de Barnaul.

 

CAPÍTULO X

Y fue, precisamente, ese desmesurado afán de notoriedad el que le condujo a tomar la decisión de partir, rumbo a la Tierra, por su cuenta y riesgo, con una tripulación compuesta por un reducido grupo de personas de su confianza.

Bien era cierto que el objetivo primordial e inexcusable de la expedición consistía en la obtención de la información necesaria, respecto del origen, desarrollo y secuenciación genética del ADN del virus sintético Luzbel. El conocimiento de la misma era fundamental e indispensable para la elaboración de un antídoto que paliase los efectos letales de dicho virus, y preservar de este modo la continuidad de la especie humana en Marte. Pero, no lo era menos, el hecho de que tal propósito, en si mismo, no era razón suficiente para abandonar las galerías de Barnaul de la manera en que lo hizo. Había algo más.

Tres días después de que se descubriera la aparición del brote vírico en la zona restringida a las investigaciones espaciales, Nemos cenaba con su compañera sentimental, Ornella Ismene en la residencia familiar, situada en la cúpula verde, en el área destinada a los miembros del Consejo de los notables. Y fue en el transcurso de esa cena, cuando se fraguó el plan que determinó la realización del viaje en solitario a la Tierra.

—¿Qué te ocurre, Nemos? – le preguntó Ornella-. Desde hace algún tiempo, te noto raro: permaneces largos ratos, a veces horas, en silencio, cariacontecido; tu mirada se pierde en el horizonte de cualquier objeto; estás inapetente, y ni siquiera tienes ganas de hacer el amor. Dime, ¿qué te preocupa?, ¿qué es eso tan importante que te enajena?, ¿qué pensamientos ahogan tu alegría, hasta el punto de abandonarte a la desidia de ti mismo y a la apatía hacia los demás?.

Nemos no respondió. Mantenía la mirada fija en la cazoleta de la cuchara que sostenía en una mano, y que aún no había introducido en el potaje de cereales que humeaba en el plato.

—¿Pero no te das cuenta de que no puedes seguir así? ¡Tienes que despertar de esa pesadilla, salir del agujero, Nemos! – gritó Ornella con desesperación mordida por la impotencia-.

Éste pareció reaccionar. Levantó la cabeza, muy lentamente, como si al hacerlo estuviera rompiendo la inercia de una gravedad desconocida e insólita; y posó la mirada en el rostro de su interlocutora. Los ojos le brillaban de un modo extraño, con el fulgor de un destello metálico, con la lejanía de un reflejo de la luz de Deimos en la carcasa de una nave espacial.

Esta circunstancia no pasó inadvertida para Ornella. Nunca la había mirado así. Nunca lo había sentido tan distante, tan poco humano. Y se estremeció.

Nemos, de pronto, balbuceó unas palabras ininteligibles que se ahogaron en su propia garganta. Luego carraspeó. Y, con esta acción, pretendía limpiar la laringe; aunque, al hacerlo, más bien pareció que había liberado la emoción contenida, las frustraciones apostilladas y la mendacidad de tantos siglos a la sombra acumuladas en la remansada sangre de las acequias de su corazón; porque, súbitamente, empezó a hablar con una energía inusitada, que sorprendió a Ornella.

—Hace unos días - comenzó a exponer - constatamos la presencia del virus que asola nuestra comunidad en el área de investigaciones espaciales. Fueron muchos los contaminados, y varios de ellos se hallan en situación crítica. Por suerte, a mí no me ha afectado.

—¡Qué feliz me siento al oírte decir esto! Estaba empezando a temer lo peor - exclamó interrumpiéndole Ornella-. Y, ¿qué habéis pensado hacer?

—De momento - prosiguió Nemos- evacuar a toda la población a un lugar seguro, que probablemente será la antigua explotación minera de Barnaul. Mañana mismo se pondrá en marcha el dispositivo de emergencia, que dará inicio a las operaciones de traslado y realojamiento de las personas no afectadas por la pandemia. Nosotros también habremos de mudarnos a la zona protegida de Barnaul.

—Sí. Allí estaremos seguros - afirmó Ornella-. Pero, ¿hasta cuando tendremos que permanecer en las galerías subterráneas?

—¡Vaya pregunta! – protestó Nemos-. Pues, hasta que logremos erradicar la plaga que asola nuestra comunidad. Y eso sólo será posible, cuando conozcamos el origen y características del agente que la ha generado.

—Y, ¿no sabéis nada de él? – insistió Ornella-.

—Sabemos muy poco a ciencia cierta - confesó apesadumbrado Nemos-. De todas formas – continuó-, después de darle muchas vueltas a la información con la que contamos, he llegado a algunas conclusiones que, en el caso de que sean correctas, nos sitúan a las puertas de la extinción de la especie humana.

—¡Por favor, no sigas! – suplicó gimoteando la mujer-.

—¡Tranquila Ornella! Deja que te cuente – se apresuró a decir Nemos, después de tomarse dos cucharadas del potaje-.

—Es verdad, la situación es extremadamente grave, no lo niego; pero hay que afrontarla en los términos que se nos presenta. No hay otra solución. Conocemos la naturaleza sintética del virus, lo cual nos obliga a pensar, indefectiblemente, en sus promotores. Éste no ha sido creado en nuestros laboratorios; por lo tanto, su procedencia es extramarciana.
Y el único lugar de la galaxia en el que pueden existir seres inteligentes capaces de crearlo, que nosotros sepamos al menos, es la Tierra.

—Pero, ¿no hace ya un montón de siglos, desde la gran explosión atómica, que no se sabe nada de ella? ¿Es que estábamos equivocados, y resulta que hay vida humana en el planeta madre? – le interrogó Ornella, un tanto confundida-.

—No puedo afirmarlo con certeza – aseveró Nemos-; aunque, como te he adelantado, he desarrollado una teoría al respecto. Sí, unas semanas antes de la constatación de la existencia del virus mortal, en la región de Tarsis se registró un incremento extraordinario y anómalo de la actividad meteorítica habitual en ella, al mismo tiempo que los radiotelescopios situados en la región de Oxie y Plaus y en la sima Candor verificaron la emisión de señales radioactivas procedentes de la Tierra. Pues bien, he llegado a la conclusión de que la aparición del virus en Marte está relacionada con estos fenómenos físicos. Es más, estoy convencido de que el virus se ha transmitido de la Tierra a nosotros, a través de esas ondas radioactivas que, por cierto, coinciden en su estructura molecular con las que se detectaron en la última emisión que llegó a Marte, hace seis siglos, como dices. En consecuencia, creo que los mismos agentes que desencadenaron el holocausto nuclear terrestre pretenden ahora nuestra aniquilación.

—Y, ¿quién puede ser el causante de la tragedia? ¿Quién está detrás de todo esto? – preguntó Ornella, aterrorizada-.

—Habrá que averiguarlo – propuso Nemos-.

—¿Cómo? – dudó ella-.

—¡Cómo va a ser! Yendo a la Tierra, ¡claro está! – gritó Nemos algo irritado-. De hecho, el Consejo de los Notables se reunirá pasado mañana para concretar los detalles de los preparativos de la futura expedición.

—¡Ay, querido! ¡El Consejo de los Notables...! – le interrumpió Ornella-. Seguramente tardarán varios días en deliberar cuál ha de ser el nombre de la expedición. Esos carcamales se enredan en la tela de araña de las cuestiones formales, y rara vez afrontan el meollo del problema. Además, te relegarán a un papel secundario, como siempre, en beneficio de su favorito Vadik.

—Puede que tengas razón – aceptó Nemos-.

—Sabes que sí – confirmó Ornella-. ¿no te das cuenta? Tú vales más que todos ellos juntos. No puedes permitir que vuelvan a burlarse de ti, obligándote a actuar al dictado de sus arbitrarias decisiones. Esta vez, no. No lo soportaría. Me moriría, si tuviera que aguantar a mi hermana Destra, mofándose de mí con su comentario preferido: “Uy, Nemos, otra vez de perrito faldero”. ¡no, Nemos! ¡Tienes que hacer algo!

—¿Qué debería hacer?- rogó Nemos-.

—¿Y me lo preguntas? – se extrañó Ornella-. ¡No lo dudes! Tienes que olvidarte del Consejo de los “maquiavelos”, y actuar por tu cuenta. Ésta es la ocasión que estabas esperando, tu gran oportunidad. Por fin vas a poder demostrar a los miembros del Consejo tu verdadera valía. Ha de triunfar el héroe que hay en ti. Tú serás el salvador de la especie humana. Todos te aclamarán como su líder. El Consejo, Vadik, mi ponzoñosa hermana, todos se rendirán a tus pies; te agasajarán; te brindarán pleitesía y honores. ¡Ay, Nemos! Degustarás, al fin, la hidromiel de la gloria.

Nemos quedó pensativo. Ornella había puesto el dedo en la llaga de su vanidad, y había arrancado la postilla de las frustraciones, de los deseos reprimidos y de los sueños rotos, en una obediencia impuesta por quienes nunca le otorgaron un papel principal en el gobierno de la colonia humana en Marte. Y la ambición brotó por la herida abierta, a borbotones de delirios de grandeza. En ese preciso instante, Nemos decidió ser el protagonista de la misión espacial a la Tierra.

A la mañana siguiente, se reunió con sus colaboradores Mur-Alkami y Emil Salocin, a quienes puso al corriente de sus investigaciones e informó acerca de sus intenciones. Todos se pusieron de acuerdo, y decidieron conformar una tripulación compuesta por ellos mismos y otras tres personas de confianza, que partiría en dirección a la Tierra, sin esperar las órdenes del Consejo, cuando estuviera lista la nave Pathfinder, la misma que hacía unas horas habían abandonado a su suerte. Y así lo hicieron.

La nave nodriza se perdió en la lejanía, orbitando la Tierra con un destino incierto.

Ahora era sólo un punto luminoso en la pantalla panorámica de la lanzadera Ramsés, que se hallaba posicionada sobre la explanada del Valle de los Caídos, a unos 2000 m. de altura, en situación estacionaria.

Nemos consultó la base de datos del ordenador, para obtener información pormenorizada acerca de la orografía del terreno y las características arquitectónicas del complejo monumental que se podía apreciar incluso desde la nave.

Una vez que recabó los datos de su interés, reflexionó sobre los mismos y consideró todas las posibilidades de acceso al lugar de procedencia de las emisiones radioactivas. Éstas se reducían a tres: una, las señales se emitían desde la nave central de la basílica; dos, su lugar de origen era la cripta jalonada por unas enormes esculturas, situada en la base de la gigantesca cruz que se levantaba en la cima de un risco; y tres, las señales procedían de alguna gruta oculta en el vientre granítico del propio risco.

Después, cuando tuvo claro qué táctica iba a desplegar, llamó a los oficiales Mur-Alkami y Emil Salocin.

—Oficiales – les saludó-, éstas son las instrucciones a seguir: Vamos a entrar en acción. Aterrizaremos en la explanada que se abre al frente del edificio central del conjunto arquitectónico del Valle de los Caídos – les dijo, mientras les indicaba el lugar exacto, marcado en azul en la imagen de un monitor holográfico-. Nos dividiremos en tres comandos, cada uno de ellos compuesto por dos personas. Usted, Emil, será el responsable de la unidad “Alfa”, y se encargará de inspeccionar las laderas Sur y Este del risco. Usted, Mur-Alkami, por el contrario, será el responsable de la unidad “Beta”, e inspeccionará la ladera Oeste del risco y la cripta en la base de la cruz. Y yo, por mi parte, comandaré la unidad “Delta”, y me encargaré de la inspección del edificio principal.

—¿Tienen alguna duda? – les preguntó el comandante-.

—¡No, señor! – respondieron al unísono los oficiales-.

—Pues bien, oficial Mur-Alkami, dé las instrucciones para poner en marcha el dispositivo de aterrizaje – ordenó el comandante-.

—¡Sí, señor! – contestó el aludido-.

 

CAPÍTULO XI

La “Ramsés” se posa dócilmente en el patio frente a la gran cruz que corona el risco. A su alrededor hay repartidos restos metálicos oxidados de antiguos vehículos, semienterrados entre cascotes y polvo amarillo.

Los ensayos realizados por las sondas automáticas han indicado que la radiactividad es tolerable y el aire respirable. Los marcianos pisan por primera vez el planeta madre, con una suerte de tristeza propia del que vuelve a casa, tras un largo viaje, y la encuentra amenazando ruina y desierta.

Sin discursos ni frases célebres, sin mediar palabra, las tres parejas de hombres se dirigen hacia los puntos acordados. Caminan tensos mirando al suelo, buscando indicios de la historia pasada. A veces miran de soslayo la planicie que tiene al fondo, vacía, amarilla, azotada por el viento, que forma fantasmas de arena que corren hacia el horizonte aullando su desgracia. Pero nada les sorprende más que el cielo azul. Acostumbrados a la noche perpetua marciana, la Tierra les parece un lugar delicado, como una esfera de cristal preparada para quebrarse en cualquier momento.

¡Malditas sean todas las Lady Macbeth de Marte! Tanto verter su valor en mis oídos para que ahora esté en un planeta que es un cementerio, llamando a las puertas del infierno. Y todo porque mi hermana Destra es una esto y tu concuñado Vadik es un lo otro. Un lo otro, “mecagüen él”, que si no es la era Terciaria, que si es el Mesozoico, que te tiro torpedos positrónicos. ¡Jesús! Si llego a decir que los mortiritas son bestias del averno, me hubiera puesto un supositorio de luzbelol…

—¡Señor, Señor! La puerta esta cerrada, ¡Don Nemos!…

—¡Ya le he oido Gutierrez de Barnaul, cálmese, coño!

—¿Utilizo el FUGEPARAN (Nota del autor: fusil generador de particulas de antimateria)?

—¡Rediós, Gutierrez de Barnaul! ¿Por que no fonostrona al Sr. Magadan y le dice que dispare uno de sus torpedos positrónicos? Utilice el microlanzallamas en posición soplete y corte alrededor de esta cosa que, para su gobierno, se llama cerradura y que es la causa de todos sus malestares. Procure no hacer muchos destrozos, es una obra de arte.

Yo no sé si es la cobaltoporfirina o la soja de Marte o anticuerpos naturales contra Luzbel, pero a todos los marcianos nos canta un achorramiento que va desde hablar a la hora del desayuno como si interpretaramos a Shakespeare hasta utilizar todo tipo de armas, cuanto más destructivas mejor, para sobrepasar la menor adversidad que se nos plantea en nuestra vida. Eso sin contar con los episodios de chapoteo homosexual. Esas sonrisitas de Salocín por los correajes de cuero no me han gustado nada y el guardapolvos de plexiglás del bueno de Mur-Alkami me da malísima espina.

—¡Comandante Tolstar! ¡Es verdad, ya está abierta!

¡Bendito Gutiérrez de Barnaul! ¡Cuantas más y mayores sorpresas nos esperan esta mañana! Si una puerta de bronce puede abrirse sin dificultad después de 600 años de estar cerrada, podemos encontrar dentro cualquier cosa.

—Empuje fuerte. Piense en ésta como en una expedición científica. No necesita armas, ya que todo ser vivo desapareció hace más de 600 años. Vamos hasta el final de la nave, parece que es allí donde la radiación es mayor…

¿Qué mente calenturienta pensó en hacer esta galería gigantesca pudiendo disfrutar del aire puro y limpio? Está visto que mi destino es vivir enterrado.

—…Acérquese a esas lápidas , yo miraré en el altar.

—Aquí unidad “Beta”. Nemos, no hay indicios de vida en esta zona. En la base de la cruz hemos encontrado una inscripción en europeo estandar: “Alejaos de Luzbel”. El interior está repleto de restos humanos y no humanos. Aquí hubo una batalla, Comandante. Por otra parte, la cruz está hueca, en tiempos hubo un ascensor y escaleras, pero ahora todo está destruido. La fuente de radiación está en la parte superior de la cruz. El análisis de imagen del fonostrón indica que se trata de una especie de baliza. Quién la puso en marcha estaba interesado en marcar este lugar durante mucho tiempo.

—Aquí unidad “Delta”. ¿No puede ser más explícito, Mur-Alkami? Ese término “no humanos” le da mucho misterio a su comunicación, pero nada más.

—Aquí unidad “Beta”. Los restos no humanos corresponden a un ser con aspecto de homínido, bastante grande, con menos huesos y…

—Aquí unidad “Delta”. O.K. Mur-Alkami, son restos de mioritas y Ud es un sencillo astronauta de combate, lo sé. Deje al facultativo Petrikilo, recogiendo algunas muestras “no humanas” y reúnase ud. con nosotros en el interior de la basílica, le gustará el ambiente recogido y monacal. Atención unidad “Alfa” informe, por favor.

—Aquí unidad “Alfa”. Ladera este sin interés, continuamos en dirección norte. No hemos encontrado ninguna gruta o cueva, puede que la entrada se haya tapado por algún desprendimiento, o quizás que la señal detectada provenga del interior de la montaña a traves de respiradores o pequeños orificios.

¿Por qué siempre me asigna las misiones más aburridas, Comandante?

—Aquí unidad “Delta”. O.K. Emil, cuando haya comprobado todo su área vuelva, con Yochbús, a la Ramses y preparen un campamento en los soportales que rodean la plaza.

—¿Cómo va todo, Gutiérrez de Barnaul?

—El máximo de radiación corresponde a esta lápida que pone RANCO, pero todo el perímetro está sellado salvo esta ranura … ¡Aaaaaahhh! Comandante es un cepo… ¡Uuuyy! Algo me está pinchando en las yemas de los dedos…

El ronco roce de piedra contra piedra llena de estupor a los dos marcianos, que observan como gigantescas lastras de granito surgen del techo y las paredes cerrando el paso desde el crucero y las capillas laterales. Unos finos hilos de láser rojo, que apuntan a sus cuerpos, les obligan a levantar los ojos hacia la cúpula, repitiendo el rito de plegaria por las almas de todos los enterrados en aquél lugar.

—Comandante, no puedo sacar la mano.

—No se mueva Artillero. Aquí unidad “Delta”. Hemos puesto en marcha una trampa, y creo que somos objetivos de múltiples armas de funcionamiento automático. Lo que fuera que nos ha traido hasta aquí, está debajo de la losa que atrapa a Gutiérrez de Barnaul. Atención unidades “Alfa” y “Beta” procedan a labores de rescate con precaución. Mayor Mur-Alkami, ni qué decir tiene que solo tomará el mando cuando compruebe que estoy muerto.

—Aquí unidad “Alfa”. Recibido.

Señor, ¿por qué ha elegido a ese mentecato de Gutierrez de Barnaul, en vez de a mí para acompañarle? Ahora se encuentra en grave peligro y yo solo puedo añorar su compañía.

—Aquí unidad “Beta”.Recibido, Nemos. Llegamos enseguida.

—A ver, Gutiérrez de Barnaul. ¡¿Qué le ha pasado?!

—He sentido que una placa metálica me aprisionaba los dedos y luego varios pinchazos, como si te clavaran agujas muy afiladas en las puntas de los dedos y una vibración.

—¡Déjeme echar un vistazo! Anímese, hoy es nuestro día de suerte: hemos aprendido lo que es una cerradura y hemos caído en una trampa que funciona solo a medias.

¿Por qué se habrá detenido la secuencia de movimientos en apuntar?¿No habrá energía en las armas que son dirigidas por estos láseres? ¡Qué bello es ese mosaico!

—No veo nada más que una llanta que le aprisiona los dedos.¿Los puede mover?

—Sí, no siento ningún dolor.

—Al final de cada láser se ve algo parecido a una ametralladora de tubos. Si no sabemos cual es el santo y seña las cosas se van a poner muy feas.

Vuelve el rumor de piedras y la luz que entra por la puerta de la basílica les baña en optimismo.

—¡Comandante, ya me ha soltado! ¡Eh! La lápida está bajando…tenga cuidado de no caerse…

—...y los láseres se han apagado… y aquí hay una galería muy bien iluminada.

En la puerta principal, los cuatro miembros restantes de la tripulación de la Ramsés observan la antigua iglesia y a sus compañeros en la boca de la fosa rectangular que se ha abierto en el suelo.

—¡Pasen! Petrikilo, eche un vistazo a Gutierrez de Barnaul. Mur-Alkami, Salocín, vengan un momento, por favor. Estamos en una situación muy mala, sin posibilidad de volver a casa, amenazados por Magadan, sin avituallamiento y en el interior de una caja de sorpresas. Propongo finalizar la exploración de ese túnel ahora mismo y, en función de lo que encontremos, trazar un plan de supervivencia en este planeta.

—Comandante, sabe que estamos a su entera disposición.

—Gracias, Mayor.

Entraremos ahí abajo, ud, Gutiérrez de Barnaul y yo mismo, mientras, ud, Salocín, esperará fuera del templo con Petrikilo y Yochbús. No quiero más sorpresas.

—A sus órdenes, Don Nemos.

Siempre igual, con ese bobo y ese cochinillo envuelto en celofán.

—Don Nemos, Gutiérrez de Barnaul está perfectamente, parece que le han tomado muestras para un análisis de sangre.

—Gracias, Petrikilo. Interesante, parece que alguien quiere asegurarse de que franquea el paso a los “seres” adecuados. Vamos, señores.

¡Jesús qué día! Por lo menos en este pasadizo me encuentro seguro. Me recuerda las callejas de las viejas ciudades marcianas. Es extraño que mantenga la iluminación, aunque tanto ésta como la trampa y las armas puedan haberse accionado por nuestra llegada, con lo que con muy poca energía cualquier sistema automático podría haber estado vegetativo estos cientos de años. El ambiente es templado y seco, acompaña a la conservación de cualquier cosa y todo está muy limpio, como si se hubiera trabajado duro para conseguir la hermeticidad de todo el subterráneo.

—Don Nemos, ahí adelante hay otra puerta.

—¿Ya ha preparado su FUGERAPAN? Disculpe el sarcasmo, Artillero.

—Parece la puerta de un ascensor, Nemos, que se abre presionando sobre este pulsador de membrana. Es curioso, una mano derecha completa.

—Sí, Mur-Alkami, dejemos a nuestro camarada que diga: ¡Ábrete sésamo! otra vez. Ánimo, Gutiérrez de Barnaul, la casa encantada ya le conoce.

—¿Qué hago? Presiono con fuerza.

—Ud mismo.

Las puertas se abren dejando paso al ascensor que predijo Mur-Alkami.

—¡Bravo, Mayor! ¿Alguna otra idea?.

—Un refugio nuclear, Nemos, creo que vamos a encontrar mucha información sobre lo que ocurrió el Día del Juicio y muchos cadáveres.

—¡Adelante, pues!

—¡No hay mandos!

No hacen falta, el sistema nos espera, ha reconocido a las personas adecuadas. Baja deprisa y muchos metros… Ya para.

—¡Virgen Santa!

—¡Coño!

—¿¡Qué es esto!?

Cientos o miles de cámaras refrigeradas, cada una de ellas con un ser humano pueblan una sala enorme. La regulación automática comienza a funcionar y los cuerpos comienzan a moverse.

—¡Hay mujeres!

—Gutiérrez de Barnaul siempre tan observador. ¿Que hacemos Nemos?

—Esperar, Mur-Alkami. Estoy seguro que todo está planeado.

El chico, por lo menos, no flojea de remos. No puedo creer que se hayan conservado vivos durante tanto tiempo, la tecnología en los últimos años de la tierra no estaba tan avanzada. Pero, ¿de qué me sorprendo? La cobaltoporfirina y sus efectos ya eran conocidos antes de nuestra salida hacia Marte. En fin, espero que puedan explicarnos, que ha ocurrido y que sean pacíficos, todo sea que tengamos que liarnos a tiros. ¿Qué idioma hablarán? ¿Tendrá el fonostrón algún decodificador de sonidos?

—Mur-Alkami, estaba pensado si podremos comunicarnos con estos individuos, con el fonostrón.

—Si la lengua utilizada está en la base de datos no habrá problemas, si no, tendremos que pensar en otra cosa. Y creo que pronto saldremos de dudas. Ahí llega uno.

Un hombre de mediana estatura, desnudo, completamente depilado, se acerca a ellos con las manos levantadas, con el paso vacilante y hablando quedamente.

—Bienvenidos hermanos. ¿Quienes sois? ¿En qué año estamos? ¿Cuál es la situación en la superficie?

—Estamos de suerte Nemos, es europeo estándar, una vez más. Pueden conectar el traductor simultaneo 5 y entenderle sin dificultades, escuche lo que ha dicho.

Es fabuloso como ha despertado de su letargo tan fresco como si hubiera sido la siesta de una tarde de verano. Menos mal que Salocín se ha quedado fuera, aunque seguro que babeará de gusto con lo que va a ver.

—Fantástico. Gutierrez de Barnaul conecte su cámara y traductor, según lo que dice el mayor y fonostre al artillero Salocín, explicándole lo que hemos encontrado y pasando la fonostración a directo.

¿Y ahora qué le digo a este hombre?: ¡Hola, somos los marcianos!. Ahí fuera solo hay viento. ¿Tienen algo para comer?

—Bienhallado. Soy el comandante Nemos Tolstar, del Consejo de Notables de Marte. Hoy es 24 de marzo de 2.704, creo, y en el exterior la radiación es muy pequeña, pero el ecosistema está muy deteriorado.

Estoy al frente de una pequeña expedición en busca de soluciones a una epidemia vírica que está diezmando a la población marciana. Acabamos de aterrizar…

De momento, no hablaré de mi concuñado y sus torpedos positrónicos

—… después de que nuestra nave nodriza haya sufrido graves desperfectos. Solo tenemos algunos datos dispersos, incluyendo la existencia de unos ciertos seres llamados mioritas o mortillitas y que hubo una guerra nuclear que, pensábamos, acabó con la vida en la Tierra, pero, por lo visto estábamos equivocados.

Necesitamos mucha información y mucha ayuda, el virus Luzbel está acabando con la vida en Marte, Señor…

—Epigmenio +34 655 714 005. Soy el Noé del Arca UE 1.713, que es el lugar en el que nos encontramos. Acompáñenme a la sala de comunicaciones y les pondré al corriente de la situación del mundo antes de que comenzara este sueño de 600 años.

—Perdonen un momento.

—Edvoldo, ¿está el “despertar” en orden?

—Salvo que ha sido iniciado en manual y 396 años antes de lo previsto, todo está de acuerdo al procedimiento.

—¿Quienes son estos señores?

—Amigos. Continúa con la puesta en marcha y cuando haya finalizado la fase 1, ven con Flodoberta, a la sala de comunicaciones.

—Disculpen el inciso. Mientras les explico el asunto, ¿les apetecen un café y unas pastas?

 

 

 

CAPÍTULOS XII/XIII

Emil Salocín comenzaba a dudar de las dotes organizativas de Nemos. Primero le enviaba a custodiar la puerta de un templo en medio de un paisaje yermo de vida y a los cinco minutos reclamaba su presencia en la sala de comunicaciones pidiéndole que obviara la tareas de protección.

Para alguien que se había educado bajo los cánones de una rígida disciplina militar copiada de los hoplitas de Esparta no era fácil entender la falta de rigor y determinación en el trabajo.

Cuando el jefe de artillería descendió del ascensor de camino a la sala, no pudo creer el espectáculo. Cientos de hombres y mujeres desnudos que olvidaban el pudor por la alegría de recuperar la consciencia, se fundían formando enjambres de vidas que trataban de ordenar sus recuerdos. Entre tanto desconcierto Emil consiguió intuir la figura de Mur-Alkami tras un ventanal de metacrilato que enmarcaba un panel lleno de monitores e interruptores.

—Ya estamos todos – dijo Nemos dirigiéndose a Epigmenio cuando finalmente entró Salocín - Si eres tan amable puedes comenzar

Emil no pudo evitar una disimulada sonrisa al escuchar el nombre, que se apresuró a esconder tras una falso ataque de tos. Mientras tomaba asiento junto a un hombre cincuentón que escondía sus vergüenzas bajo una improvisada túnica blanca, pudo comprobar que a parte de los miembros de las Pathfinder solo había otras cuatro personas más, todos ellos hombres que se diferenciaban entre si por el número de arrugas que dibujaban sus caras. Por lo demás parecían lo que eran, unos supervivientes.

Sobre la mesa de cristal unas tazas de café a medio terminar indicaban que ya se habían hecho las oportunas presentaciones. Epigmenio tomó la palabra a Nemos quien, por lo visto, le había puesto en antecedentes de las peripecias de la Pathfinder:

—El año 2050 se descubrió una megalópolis debajo de la pirámide de Keops, sin embargo lo que nunca trascendió a la opinión pública fue que junto a los restos muertos de una civilización desaparecida por razones desconocidas, se encontró en la base de la pirámide unos laboratorios que contenían 6000 Mioritas criogenizados.

Ne mos se permitió interrumpir a Epigmenio en su exposición.

—Perdone, estimado Epigmenio, pero, ¿cómo se llegó a descubrir la megalópolis? Las excavaciones en aquella zona datan de miles de años y jamás se había encontrado ningún indicio de la existencia de una ciudad oculta.

—Tiene razón, amable y contumaz comandante Nemos. En realidad las pirámides eran una especie de mojones indicadores. La ciudad se halló a una profundidad de casi 4.000 metros y no por casualidad. La clave se encontró en la Luna. En el año 2050 una expedición descubrió allí una extraña construcción de factura claramente no humana, pero, sin duda, sí de alguna especie inteligente. Estaba oculta bajo el cráter Schickard. eran kilómetros y kilómetros de túneles y galerías que, como una tela de araña se extendían a unos quinientos metros por debajo de la superficie del cráter. En el centro de la red, como su araña creadora, una enorme sala semiesférica. Allí se hallaron dos sarcófagos con los dos primeros mioritas que nos fueron dados contemplar. Suponemos que los sistemas de soporte vital fallaron en algún momento de su hibernación, sumergiendo a aquellos seres en un sueño eterno. En cualquier caso, lo más interesante fue lo que se dio en llamar en aquel tiempo el Mapa del Tesoro. La ruptura de los sellos de entrada de la enorme cámara puso en marcha una serie de mecanismos que proyectaron sobre la enorme cúpula una imagen interactiva del planeta Tierra. Pero de una Tierra tal y como era hace 65 millones de años. Después de varios meses de investigación se descifraron las instrucciones de uso de aquellos dispositivos. Y resultó ser precisamente lo que parecía: un mapa en el que se señalaban varias posiciones, cada una de ellas correspondiente a una megalópolis como la de Gizeh, aunque esto lo supimos más tarde. A priori, después de estudiar aquellos mapas, el punto más accesible (otros muchos se ocultaban en actuales fondos submarinos) resultó ser el de Egipto. De las indicaciones que el mapa nos ofrecía sólo se desprendía que en aquellos lugares se encontraban una especie de refugios similares al de la Luna. No fue así, sin embargo. En Gizeh comprobamos que había más, mucho más..
Varios servicios de inteligencia se hicieron eco de lo acontecido, y la OTAN intervino de inmediato aislando la zona, alegando motivos de lucha antiterrorista. Lo que sucedió en Egipto en la época es conocido, aunque no lo fueron las razones.
Se formó un equipo multidisciplinar de científicos que durante una década tuvo por objeto copiar la tecnología y estudiar la civilización a partir de las bases de datos Mioritas. Desde el primer momento se supo que eran de origen extraterrestre, pero sobretodo y dado el potencial armamentístico del que eran poseedores se tuvo claro su carácter hostil hacia cualquier forma de vida que pudiera hacerles la competencia.

—Perdone otra vez, estimado Epigmenio, pero no alcanzo a entender cómo supieron tan pronto y con tanta seguridad que aquellos seres pudieran ser una especie hostil – inquirió Nemos, un tanto confuso por la rapidez con la que avanzaban las explicaciones del terrícola – Tampoco veo claro lo de su origen extraterrestre.

—Lo siento, mi querido y dubitativo comandante Nemos. Una vez más tiene usted razón, pero el ansia por hacerle comprender lo que ha sucedido en la Tierra y por conseguir que nos ayuden, me lleva a dar gran cantidad de hechos por supuestos. Olvido que en Marte nunca llegaron a saber nada. Si he de serle sincero, en aquellos momentos nadie pensó en la Colonia Olimpo; dimos por supuesto que, ocurriera lo que ocurriera en la Tierra, su suerte sería más bien oscura. Veo que nos equivocamos. Ahora son una esperanza, quizá la única.

—Gracias, amigo Epigmenio, pero nosotros también andamos necesitados de ayuda. Por favor, prosiga.

—Bien, luminoso comandante. Lo del origen extraterrestre de los mioritas no fue deducción; ellos mismos nos lo confirmaron. En cuanto a lo de la hostilidad, esto nos quedó claro ya a partir de los primeros anales que encontramos en Gizeh. Los mioritas son originarios del sistema solar Calíope. Hace 65 millones de años arribaron a nuestro mundo huyendo de algún tipo de catástrofe a escala planetaria. No nos quedó claro, pero pensamos que su planeta originario estalló a raíz de algún experimento militar que estaban llevando a cabo.

—Joder – exclamó Nemos – Menudos angelitos.

—Sí, así es, impetuoso comandante Nemos. El caso es que consiguieron instalarse y desarrollarse con éxito en nuestro planeta. Al menos al principio. Llegaron a multiplicarse y extenderse lo suficiente por todos los continentes como para esquilmar los recursos naturales en apenas unos miles de años. Ellos, los mioritas, fueron los causantes de la extinción de gran parte de las especies de dinosaurios. Es casi seguro que al final se enzarzaron en una guerra a escala mundial. Creemos que fueron capaces de desviar algún asteroide desde el Cinturón y dirigirlo contra la Tierra, en un intento de uno de los grupos en liza por aniquilar a sus oponentes por el control del planeta y sus recursos. Pensamos que no previeron el nivel de destrucción que iban a causar. Al final lo único que lograron fue sumergir la Tierra en un prolongado invierno que aniquiló las ya escasas especies supervivientes.

—Y, como hicieron ustedes, se ocultaron en las entrañas del planeta para intentar sobrevivir, ¿no es así, compañero Epigmenio?

—Sí, mi querido y perspicaz comandante. Su tecnología no les permitió eludir una nueva destrucción casi tan grave como la sucedida en su mundo. Más bien lo contrario. Sin embargo, sí que era adecuada para la construcción de ciudades subterráneas, capaces de resistir millones de años. Al menos algunas de ellas. Con los mapas de la Luna como referencia escaneamos la Tierra y comprobamos que, de la veintena que se señalaban, sólo se habían mantenido incólumes seis de ellas. Primero abrimos Gizeh. Luego Shanghai y finalmente Narvik.

—¿En las tres encontraron mioritas criogenizados?

—Sólo en Gizeh. Suponemos que sus despertares estaban programados para que se produjeran de forma progresiva, cada cierto periodo de tiempo, aunque esto es sólo una teoría. Shanghai y Narvik estaban vacías de seres vivos. La razón de esto sigue siendo un misterio. Sin embargo, no fue así en las tres megalópolis submarinas. Con la tecnología de que disponíamos en aquella época, estas ciudades resultaban inaccesibles. No obstante, sabiendo como sabíamos dónde buscar, pudimos localizarlas desde los satélites y determinar con un alto grado de seguridad, que se encontraban intactas.

—Vaya, ¡qué interesante! – exclamó Nemos.

—Sí, en verdad es sorprendente, mi intrépido y epopéyico comandante interplanetario Nemos.

Nemos observó a Epigmenio durante unos segundos, un tanto amoscado.

—¡Oiga! ¿No se estará usted pitorreando?

Una gasa roja pareció cubrir la visión de Nemos Tolstar , aviso premonitorio de un ataque de cólera avasallador. La voz de su yo racional le conminaba a la tranquilidad, a la calma. Sin embargo, su yo animal, aquel que intermitentemente se apropiaba de su mente como un dios cegador, le susurraba: “¡A que le meto al tío este!”

—Nada más lejos de mi intención, comandante Nemos – respondió Epigmenio un tanto sorprendido por la intempestiva reacción del marciano.

Un Nemos más ecuánime comenzó a relajarse después de la rápida ingesta de una dosis de cobaltoporfirina. Era curioso. Después de 600 años de vida cada vez era más impetuoso y visceral y menos reflexivo y calmado. Era este un punto interesante a investigar en un futuro, si es que llegaba a existir tal.

—Creía. – respondió Nemos, todavía amenazador.

—Le percibo a usted un tanto, no sabría decir si susceptible o suspicaz, querido comandante Nemos.

—Es la edad y la extremadamente delicada situación en la que nos encontramos, que me altera algo, amable Epigmenio – respondió, mas calmado, Nemos.

—Si le parece conveniente, amigo Nemos, continuemos con la secuencia de acontecimientos.

—Correcto, camarada Epigmenio. Adelante.

—Adelante, pues, elegante comandante Nemos. –prosiguió imperturbable Epigmenio- Las investigaciones se llevaron a cabo en estos tres centros, que se repartieron por igual las cápsulas con los Mioritas. El primero de ellos se situó en El Cairo y coordinaba la explotación del Yacimiento, el segundo ubicado en Escandinavia estaba liderado por los europeos y se centró en copiar la tecnología de criogenización, por último el de Shangai liderado por los Americanos se dedicó a estudiar su desarrollo armamentístico, poniendo especial énfasis en unas armas químicas y biológicas que al parecer encontraron en uno de los laboratorios.

Pero al final de todas las cosas, el hombre encontró su naturaleza, y aunque no sabría decir si pesó más la ambición o la curiosidad, en el primer mes de 2060 entre fuertes medidas de seguridad, los Americanos en una decisión sin precedentes dieron luz verde a la descriogenización de un grupo de 2000 Mioritas.

De nuevo el rostro de Nemos reflejó la sorpresa que aquellas declaraciones le causaban.

—¿Cómo pudieron ser tan irresponsables?

—Los mioritas son seres astutos, incrédulo amigo Nemos. Algunos especímenes habían sido resucitados con anterioridad. Después de meses de investigaciones en secreto, los americanos llegaron a la conclusión de que, bajo estricto control, resucitar a un número significativo de ellos haría avanzar en progresión geométrica el conocimiento sobre la tecnología de los mioritas. Imagine. Ellos habían viajado hasta la Tierra desde más allá de nuestro Sistema solar. Decían que sus naves aún existían, ocultas en la Luna. Demostraron ser una especie de inteligencia superior que, en apenas unos días, eran capaces de hablar nuestro idioma a la perfección. Además su memoria genética les hacía a cada uno de ellos poseedor de los conocimientos acumulados por sus antecesores. A cambio de su colaboración, la Humanidad les cedería un refugio en el lugar de la Tierra que mejor se adaptara a su biología.

—Pero ellos querían más, ¿no es así, gran lider humano Epigmenio?

—Sí, mi inmarcesible y sapientísimo comandante Nemos. Querían el planeta entero. Al fin y al cabo ellos habían sido los amos del mundo cuando nuestros antepasados no eran más que una especie de ratones temerosos ocultos en madrigueras. Nosotros no éramos más que unos advenedizos, sin ningún derecho a usurpar lo que les pertenecía. El caso es que no les costó demasiado trabajo convencer a las autoridades americanas y pronto 2.000 de aquellos individuos volvieron a la vida.

Este fue el comienzo del fin. No sabemos cómo pero el Laboratorio de Shanghai cayó en su poder y lo que fue peor las armas químicas y biológicas que Estados Unidos había desarrollado a partir de las encontradas en la ciudades mioríticas, fueron utilizadas.

Los gobiernos del mundo se pusieron en alerta y comenzaron la construcción de refugios tipo megalópolis. Algo habíamos aprendido de la tecnología de los mioritas y en poco menos de un año fue posible construir instalaciones como esta en la que nos encontramos. No nos cupo duda a ninguno de que la huida y desaparición de aquel ejército de dos mil demonios no nos iba a deparar nada bueno. El altruismo no era su enseña, de eso estábamos seguros. Ellos solos habían conseguido tomar la megalópolis de Shanghai, acabar con las fuerzas de seguridad que lo protegían (20.000 soldados americanos y 350.000 chinos) y, de paso, arrasar la ciudad, orgullo de la República China. No se hizo público y todo se achacó a un enorme terremoto, pero se estima que durante la fuga murieron más de diez millones de personas.

—¡Dios mío! ¡Qué barbaridad! ¿Emplearon armas nucleares?

—No, curiosamente nunca encontramos ese tipo de armas en las ciudades mioríticas. De todas formas, mi muy eminente invitado y amigo Nemos, imagine la capacidad de destrucción del armamento que allí había. Aunque sea una frase hecha, le puedo asegurar que fue un espectáculo dantesco.

—No más que lo que vino después, intuyo.

—Así es, munífico comandante Nemos. Pero, ¿qué le sucede a su oficial Salocin? Le noto babeante.

—Ignórele, por favor, Epigmenio. Los hombres desnudos le erotizan en grado sumo y en la sala los hay por miles. Es un caso perdido.

—¡Ah! Supongo que no habrá problema si le ofrezco a alguno de mis acólitos para que se desahogue.

—Gracias, amigo Epig. ¿Me permite que le llame así?

—Por supuesto, glorioso comandante y amigo Nemos. Estaré encantado de ser depositario de su afecto y confianza.

Tolstar miró a Emil Salocin con gesto de resignación, sugiriendo con el blanco de sus ojos una agonía infinita.

—A ver, Salocin, retírese un ratito con alguno de esos pimpollos a la otra sala y deje ya de joder con sus memeces.– Volviéndose hacia el terrícola – Menos mal, Epig, así podremos continuar nuestra apasionante conversación. – dijo Nemos, mientras Salocin le dirigía una mirada de fervor y agradecimiento infinitos.

—Prosiga, por favor, querido Epig.

—Será un placer, mi querido Nemos. Casi un año después aparecieron los primeros brotes víricos en varias ciudades asiáticas. De alguna manera parecía que el virus permanecía latente durante unas semanas hasta que se manifestaba de forma letal, acabando con la vida de un humano medio en menos de 24 horas. Este aletargamiento de los trastornos genéticos provocó que para cuando se cerraron las fronteras aeroportuarias ya fuera demasiado tarde.

El contagio se producía vía respiratoria, por ingestión de alimentos e incluso por contacto. Bastaba con beber un vaso de agua contaminada, respirar la última exhalación de aire de un enfermo o tender la mano a un portador para sellar tu último mes de vida.

La mortandad fue enorme. Los epicentros de la plaga fueron precisamente las megalópolis y la extensión del virus de una rapidez inusitada. No obstante pronto tuvimos clara la forma de acabar con el virus: era altamente sensible a la radiactividad. De hecho una dosis similar a la que se recibe en unas sesiones de radioterapia bastaba para terminar con la enfermedad. Por eso nos encuentra usted así de lampiños.

El problema lo tuvimos con el prolongado periodo de incubación, de forma que cuando quisimos reaccionar ya era demasiado tarde. Comenzaron a morir miles y miles de personas por todo el mundo de forma repentina. Puede imaginarse el caos y el pánico. En las pocas semanas que empleamos en hallar el antídoto ya habían fallecido más de 400 millones de personas.

Nemos se sintió horrorizado, pero era cierto que allí podía estar la salvación para los supervivientes de Barnaul. No pudo evitar sentir un escalofrío al recordar a los que habían quedado en Marte.

Epigmenio prosiguió narrando los acontecimientos

—Como le he explicado, ya desde la huida de los 2.000 mioritas se había puesto en marcha un plan de crisis consistente en crear lo que se vino a llamar varias Arcas de Noé: construcción de bunkers acorazados donde se dispondrían cápsulas de criogenización que habían sido desarrolladas por el laboratorio de Escandinavia basándose en la técnicas Mioritas, con el fin de asegurar la supervivencia de la especie humana. De esta forma conseguiríamos salvar nuestra existencia si encontrábamos la manera de deshacernos de los millones de afectados y de los Mioritas renacidos. En estos momentos de confusión y debilidad llegó el golpe final. Aquellos 2.000 regresaron, acompañados esta vez de hordas de congéneres, sin duda resucitados en alguna de las ciudades submarinas. Si dos mil pudieron arrasar Shanghai, imagínese a más de cien mil campando por toda la Tierra después de haber minado nuestras defensas con el virus Luzbel, como ustedes lo llaman. Sabemos que en unas pocas semanas acabaron con prácticamente todos los habitantes de Sudamérica. Demostraron ser metódicos e implacables.

—Y ya sólo quedaba una solución – apostilló Nemos.

—Así es, mi precognitivo y clarividente comandante Nemos. Fue una decisión terrible. Pero nos enfrentábamos al exterminio. Arrasar el planeta y acabar con ellos, aun a costa de mil años de sueño y un duro volver a empezar o perecer sin remedio.

El virus Luzbel solo podía ser eliminado según le he explicado, por lo que se decidió crear un eterno verano nuclear. Este fue el origen del holocausto. El mayor sacrificio humano hecho jamás en pos de la supervivencia.

—Debió ser difícil, amigo Epig, no lo dudo. Sin embargo parece que ellos también hallaron refugio a la hecatombe en sus ciudades submarinas y ahora han vuelto a la carga. Y esta vez nos ha tocado a nosotros en Marte. Imagino que piensan que somos los últimos humanos a exterminar antes de la victoria final. El virus está activo allí, aunque parece menos virulento de lo que me cuenta. Quizá sea por efecto de las condiciones marcianas, pero en verdad su forma de actuar es la misma. Tengo la esperanza de que el remedio que usted me ha explicado sea igual de efectivo en mi planeta.

—Así lo deseo yo también, mi fosforescente como las estrellas comandante Nemos. En cualquier caso, parece que todo vuelve a empezar – suspiró Epigmenio, compungido.

—Sí, y debemos afrontar la lucha, mi querido epítome de la resistencia humana – concluyó Nemos.

En aquel momento Salocin y el mancebo terrícola regresaron a la sala de reuniones. Este último venía completamente desnudo con una erección más que notable mientras sufría con evidente placer los embates de las manos ansiosas de Emil quien, con fruición, acariciaba los poderosos glúteos del jovencito.

—¡No me joda, Salocin, no me joda… No me joda! ¡Me cago en la puta que le parió! ¿Será posible? – gritó Nemos, fuera de sí, mientras sentía como la sangre hirviente le inundaba el cerebro y le llevaba al borde de la apoplejía.

—Se habrá quedado a gusto – continuó Nemos. – La Humanidad a punto de ser exterminada y usted no puede aguantarse las ganas de echar un polvo. Y además nos lo pasa por los morros – le espetó, ácido, Nemos.- ¡Hostia puta! Deje de sobar ya al pipiolo ese o le capo, como me llamo Nemos.

—Lo siento, señor. Pero echo tanto de menos a mi amigo Warran… – gimoteó Emil.

—¿A su amigo Warran, dice? ¿A la loca esa? Desde luego que me voy a cagar en su puta madre, Salocin. Ande… Ande... Que ya me está jodiendo. Salga, salga de aquí y no me toque más los huevos. Haga la próxima guardia. Releve a Petrikilo – se resignó Nemos, impotente.

—Cálmese, querido Nemos, que le va a dar algo. –Le tranquilizó Epigmenio.

—Calle, calle, amigo Epig, no se imagina usted ni remotamente el suplicio que me supone la tripulación. Y encima tengo que aguantar al obseso sexual este de Salocin. ¡Qué viajecito nos ha dado! De verdad se lo digo. Creo que le ha tirado los tejos hasta a Yochbus.

—En verdad concuerdo con usted, excitable comandante Nemos, en que el mencionado tripulante no fue especialmente agraciado por los azares de la genética – señaló Epigmenio, mientras se rascaba la entrepierna. – Pero ya sabe, los jóvenes son así, impulsivos y repletos de energía y, en ocasiones, no tienen demasiado clara su sexualidad…

—Este sí, ¡joder! Este lo tiene muy clarito. ¡Hostias! ¡Que se esté quieto! ¡Lárguese ya de una puta vez a hacer la guardia! – volvió a encenderse Nemos con el comportamiento del informal Salocin.

Tolstar enarcó las cejas, agitó la cabeza y lanzó un bufido cargado de resignación y desánimo. No quedaba otra que bregar con aquella cuadrilla de ineptos de la que sólo se salvaba el eficiente Mur-Alkami. E intentar salvar a la especie humana con ellos. Y con Vadik. Al menos tenía la esperanza de que en su próximo encuentro hiciera el esfuerzo de estar más calmado. Lo tenía claro, su primera acción después de la conversación con Epigmenio sería ponerse en contacto con Magadan. Ahora se daba cuenta de que el consejo de su esposa Ornella no había sido acertado. No era momento para el enfrentamiento y la disensión, sino para el diálogo y la mutua colaboración.

Ciudad miorita de Ryléh, en algún lugar del Atlántico Sur

La sala oval, desnuda de adornos, estaba teñida de una luz verde. En torno a la mesa circular que se situaba en el centro de la habitación se sentaban cuatro seres de apariencia humanoide. De piel color marrón con tonos irisados que giraban al naranja, los ojos amarillos de aquellos cinco seres enfocaban una esfera de acuoso aspecto que reposaba sobre la mesa. Uno de ellos levantó una mano de cuatro dedos y en un lenguaje que a un humano se le hubiera asemejado a una secuencia de chasquidos interrumpidos aleatoriamente por silbidos y aspiraciones, se dirigió a sus acompañantes.

—Malas noticias, camaradas. Como habéis podido ver aún no hemos conseguido nuestro objetivo.

—Así es, Ct-Nyar, así es. Estas ratas evolucionadas parecen resistentes, no hay forma de acabar con ellos – habló Ct-Latho mientras la cresta membranosa que le cubría los hombros se elevaba, reflejo de su irritación.

—Parece increíble que sigan resistiendo el virus. Y más aún que en tan poco tiempo hayan sido capaces de llegar aquí desde el cuarto planeta.

—¿Cómo debemos actuar ahora? – inquirió Ct-Thep, mientras sus ojos giraban en torno a la mesa.

—Las restantes ciudades submarinas ya conocen la llegada de la nave humana; han sido oportunamente informadas, Ct-Thep. También se les ha hecho saber que dos naves más se están colocando en órbita estacionaria. No cabe duda de que los habitantes del cuarto planeta saben que el virus ha llegado desde nuestro mundo. Por desgracia en la zona en la que han aterrizado los primeros humanos la radiactividad residual aún resulta mortal para nosotros. Las ratas, sin embargo, son increíblemente resistentes a ella. Resulta casi imposible acudir a ese punto y exterminarlos – habló Ct-Nyar.

—¿Cuántos de los nuestros están despiertos? – preguntó Ct-Thep.

Ct-Nyar acarició la esfera y cerró los ojos.

—Somos 20 en Ryléh. Cinco en Shogoth y tres en Azath.

—No es suficiente. ¿Y en criogénesis?

—Entre las tres ciudades unos 12.000. Ya sabéis que el ataque nuclear humano mató a cien mil de los nuestros al cogernos desprevenidos.

—Sí, aquella fue una acción inesperada por parte de las ratas. –reflexionó en voz alta Ct-Thep- Ciertamente tenemos un problema: nosotros nunca desarrollamos armas nucleares y, en consecuencia, ahora no disponemos de equipos de protección. Un ataque al equipo humano que ha desembarcado sería un suicidio – concluyó Ct-Thep.

—Podemos emplear nuestros misiles – sugirió Ct-Zog.

Ct-Nyar se puso en pie. Sus largas piernas comenzaban en las caderas. A partir de esta primera articulación se curvaban hasta unas gruesas rodillas desde las que nacían las cuatro extremidades finales que se apoyaban en el suelo. Entre ambas piernas su abdomen, en forma de cono truncado, se inflaba primero y exhalaba a continuación por los poros de la brillante piel que lo recubría, nubecillas de vapor rosado. Aquello era síntoma inconfundible en un miorita de que algo parecido a la ira lo estaba poseyendo.

—La mayor parte de nuestras armas estaban siendo empleadas en la lucha contra los humanos cuando se inició el holocausto nuclear. Sin los recursos de la superficie es imposible construir mas. Aún disponemos de un remanente de máquinas de destrucción y hemos disparado dos contra las naves que se aproximan, pero hemos fallado. Ellos tambien las hacen funcionar basándose en el principio de incertidumbre. Por tanto la única forma de destruirles es esperar a que tomen tierra en el continente norte, donde sus compañeros de la primera nave y enviar un comando suicida. –finalizó Ct-Nyar su discurso.

—O rezar a Yog-Thulú y tener fe en nuestro señuelo del continente sur – apostilló Ct-Thep – Allí las radiaciones son tolerables durante breves periodos de tiempo para nuestra especie y, si caen en la trampa, podremos aplastarles.

 

Nave Viking, a las órdenes del Comandante Vadik Magadan

Después de varias semanas de tensión durante el tenaz acoso a la Pathfinder de Tosltar, la persecución había finalizado. Ahora Vadik se encontraba relajado. Había recapacitado sobre su actuación durante el ataque a la nave de Nemos y había llegado a la conclusión de que se había precipitado. Su reciente conversación con el comandante le había puesto al corriente de la situación en el Valle de Los Caídos y de los sucesos acaecidos 600 años atrás.

Contempló durante unos segundos el cuerpo durmiente de Al-Yakhint, con su larga cabellera rubia ocultando sus efébicas facciones. El joven oficial había sido especialmente complaciente aquella noche. Sin duda el saber que en pocas horas se reuniría de nuevo con su amante Salocin le había hecho entregarse al amor con un fervor especial. Nunca hubiera pensado que aquellos dos pudieran conocer tal cantidad de perversiones, pero, desde luego, durante aquella noche con el oficial Warran había descubierto unas cuantas. Sentía una punzada de remordimiento, pero, al fin y al cabo, Destra no tenía por qué enterarse.

Lanzó una última mirada a Warran y abandonó el camarote. Debía ordenar el descenso y reunirse con Nemos Tolstar. Era hora de iniciar la reconquista de la Tierra.

 
CAPÍTULO XIV

Minas de Barnaul. Marte. Cueva 23 Principal segunda

—Madre, conozco muy bien a Vadik y su incontinencia sexual. Algo me dice que me está sustituyendo y no lo toleraré. Soy una Ismene. Recuérdalo madre.
—Pero hija, si en la nave de Vadik sólo hay hombres. Y además su misión es tan importante que no creo que le deje tiempo para otros menesteres.

—Ninguna de esas razones me tranquilizan. Después de mas de 600 años de vida Vadik tiene una capacidad para adaptarse fuera de toda duda. Si no hay mujeres, utilizará cualquier mancebo. Además recuerda que va detrás del arrogante calzonazos de Nemos. Seguro que la persecución le deja ratos libres.

Ciudad miorita de Ryléh, en algún lugar del Atlántico Sur

—Ct-Nyar, ¿por qué odiamos a los ratas humanas?

—Nuestra propia existencia exige que eliminemos a cualquier otra especie. O ellos o nosotros. Cuando evoluciones un par de dextrones más lo sentirás dentro y lo entenderás, Ct-Chencho.

—¿Nos quitan la comida o el agua?

—No exactamente. Nos molestan, son diferentes. No tienen derecho a existir. Nosotros somos superiores.- Un ligero temblor del labio superior coincidió con el final del discurso.

Valle de los Caidos. Tierra

—¿Seria posible, caro Epig, utilizar la radiación nuclear a modo de antidoto? Como si fuera aquella rancia radioterapia que utilizaban nuestros antepasados para detener el avance de carcinomas específicos.

—Habría que realizar pruebas clínicas previas y desgraciadamente debería ser con enfermos o infectados.

—¡Petrikilo! Venga por aquí y tráigase la muestra estanca del Luzbel. ¡Mur- Alkami! Traigame a Salocin. Búsquelo detrás de algún miembro de esta cripta.

Nave Viking, a las órdenes del Comandante Vadik Magadan

—Pero, señor, el descubrimiento de Nemos es crucial para salvar la colonia e incluso a la especie humana. Sea usted razonable.

—Vadik, usted conoce perfectamente sus ordenes. La misión de un militar es cumplir las ordenes encomendadas: detenga a Nemos Tolstar y encuentre un antídoto para el Luzbel. Le sugiero que descienda a esa especie de panteón radioactivo y encierre a todos los amotinados. Dejo a su juicio como actuar con los humanos allí conservados. Actúe con rapidez, la adaptación del virus a la presión de Barnaul es asombrosamente rápida. Parece un engendro de una mente jodidamente inteligente y destructora. No nos queda mucho tiempo. Narcis Menta acaba de simular la situación y el resultado no es precisamente halagüeño.

—¿Cuánto?

—No mas de 3 ó 4 semanas.

—¿Lo sabe la gente?

—No. Pero lo intuyen. Tengo al Consejo agotando las reservas de cobaltoporfirina. Por cierto su mujer debe estar algo “amoscada”. Me ha pedido unas doscientas veces permiso para fonostrar con usted. Ya le dicho que las comunicaciones estan reservadas al personal militar. Pero ya sabe lo contumazmente insistente que puede llegar a ser. Es una Ismene. Así que mi buen Vadik, limite el uso de su aparato genital a las labores puramente fisiologicas.

Ciudad miorita de Ryléh, en algún lugar del Atlántico Sur

—Ct-Latho, propongamos un acuerdo a las ratas. Comuniquemos con su nave y ofrezcamosles el antidoto a cambio de protección contra la radiación. Propondremos el abrazo de Bergara en el continente sur, en lo que ellos llamaban Rio de Janeiro.

—Ct-Nyar, localizaran el origen de nuestra mensaje. Nos descubriremos y desconfiaran.

—Arriesguémonos. Estando debajo del océano nuestro riesgo es menor. Les diremos que nuestra centro científico está en Rio y por tanto allí esta el antídoto. Ten en cuenta que conocen nuestras señales desde ese lugar.

—¿Y, luego?

—Destruimos a las ratas. Somos técnicamente, tácticamente e intelectualmente superiores. Y, además, somos más.

 

 

 

CAPÍTULO XV

Nemos y los suyos, aunque no sin prevención de Gutiérrez de Barnaul, entraron aquella noche en las Arcas de Noe supletorias - por el número de arcas libres no había caso pues Epigmenio, Edvoldo y toda su parentela tenían muchas tareas por delante tras haber abandonado su sueño eterno -, que habían quedado vacías muchos años atrás, cuando toda la colonía del Valle de los Caídos se echó a dormir un sueñecito. Durmieron y durmieron. No parecía tener fin su sueño infantil en el fondo de aquel cansancio acumulado. La programación de los habitáculos, claro, sin ser avisados de ello los durmientes, hizo que durmieran un día seguido con sus veinticuatro horas redondas de los más soberbios bemoles. Precisamente por gusto del ingeniero programador del sueño, de nombre Edmundo, para aclimitarse a la atmósfera terrestre y para evitar el cuarteamiento de la piel debido a la muy intensa navegación espacial. Pero de esto nada sabía los marcianos excepto el lider Epigmenio. Como tampoco sabían nada acerca del modo de despertar, ya que serían robados al sueño suavemente, con una tonadilla terrestre :

Suddenly
I´m not half the man I used to be
There´s a shadow hanging over me
Oh yesterday came suddenly

Qué melodia tan melíflua con ese fondo lentamente metálico de guitarra acústica para un tan lindo despertar. Según les desveló Clodoberta más tarde, bien entrada la mañana, sus oídos habían sido regalados con una música antiquísima que hicieron famosa allá por el siglo veinte cuatro jovencísimos melenudos.

Con las últimas palabras de la letra y aquel alargado oh final del solista ...

Oh I believe in yesterday ...

las puertas de sus cunas de tiempo se abrieron sin sonido perceptible y nuestros argonautas abandonaron la microatmósfera de oxígeno enriquecido para encararse con la cripta y el futuro que ya estaba allí. Tras la ardua recomposición inicial, se incorporaron y a pie de arca, tenían a Clodoberta y Edmundo, hospitalarios y sonrientes.

—¿Qué ha pasado? – preguntó Nemos Tolstar una vez que tomó conciencia de quién era.

—Nada más que un sueñecito – agregó Edmundo graciosamente.

—Hambre voraz que tengo – cuasigritó nuestro apreciado Gutiérrez de Barnaul, al tiempo que con ambas manos frotábase la barriga.

—Hemos pensado Edmundo y yo, queridos peregrinos de Barnaul, que estarán más cómodos con nuestras túnicas isotérmicas.

—Bien hombre bien – reflexionó en alto Gutiérrez de Barnaul - ¿y los demás? Veo poca gente en la cripta.

—Como se podrá usted imaginar, señor Gutiérrez, hemos estado tanto tiempo inactivos en las arcas que lo suyo era volver a la superficie y disfrutar de nuestro planeta azul – sentenció Edmundo – o por lo menos de lo que nos haya quedado de él.

—Epigmenio y los demás esperan en la explanada con una temperatura ambiental de veintitrés grados centígrados centígrados y un cielo de nubes y claros.

—Subamos pues sin más dilación – manifestó Nemos.

—Sí vayamos, presiento que va a ser un día magnífico – repiqueteó nuestro travieso Emil Salocín.

Corría una brisa fresca por el pasillo que llevaba a la salida de la cripta. El cortejo de marcianos, abierto por Tolstar y Mur-Alkami, ya tocados con unas túnicas de un suavemente color azulado, quizá índigo, se acercaban a la lápida que les había “franqueado” el paso a este mundo subterrestre. Se abrió con la magnificiencia que provocan la lentitud y el roce de la recia piedra contra sí misma, todo esto gracias a la intervención de Clodoberta, que había pulsado el botón oculto en un hueco invisible de la pared.

Era media mañana, en la hora cercana al cenit solar. Ya a cielo abierto, con un sol que calentaba suavemente, se sorprendieron por el ambiente festivo que reinaba en la explanada: había multitud de mesas con terrícolas arremolinados conversando y riendo. Habían aposentado las mesas cerca de la entrada al santuario y de fondo tenían las montañas y un cielo casi limpio de nubes. Al notar la presencia de la comitiva, todas las miradas se volvieron hacia ellos y les sonrieron con una calidez inconfundible. Epigmenio se incorporó entonces y les invitó a sentarse :

—¿ Qué tal el despertar, queridos huéspedes?

—No ha estado mal el descanso pero ¿cuánto tiempo hemos estado en esas burbujas? – interrogó Gutiérrez de Barnaul.

—Sólo veinticuatro horas, señores de Marte. Y usted Nemos, mi salvífico comandante ¿ha descansado convenientemente ...?

—La verdad es que estoy totalmente recuperado del viaje, gracias por sus atenciones, Epigmenio – contestó Tolstar con un tono grave pero correcto y un semblante de reflexión.

—Pero siéntense por favor, siéntense, hagan el favor – les conminó Clodoberta.

Tomaron asiento en una mesa surtida de vasos llenos de bebida y pequeños platos con comida desconocida para los marcianos. Tras largos años de hibernación, los terrícolas habían resucitado a una nueva vida y aprovechaban este tiempo para aclimatar sus mentes y también sus cuerpos. Nada sería fácil a partir de ahora mas de momento no querían pensar en el devenir de sus vidas en aquel antaño llamado planeta azul.

La distendida algarabía se vio completada por un acompañamiento musical a cargo de un Noe alto y enjuto al que la túnica azulada le daba un aspecto de vate místico o profeta de antiguas religiones. Cantaba éste con voz profunda y se acompañaba de un omnipresente órgano electrónico capaz de emitir cualquier sonido con profusión de casi milagrosos armónicos. Entonces, Epigmenio hizo los honores :

—¿Tomaran algo para beber, mis sinpares aeronautas?

—Algo sí me apetece, que no sea cobaltoporfirina, claro está – apostilló el comandante Tolstar con gravedad reflexiva.

—Sí sí mi comandante, tiene usted toda la razón del mundo. Debemos aprovechar la estancia en la Tierra, para cambiar un poco nuestro cansino régimen de soja y cobaltoporfirina – apostilló con nerviosismo y los ojos abiertísimos nuestro Gutiérrez de Barnaul.

—Magnífico, estruendoso – reclamando la atención, agregó Salocín.

Yochbús y Petrikilo rieron casi a coro como muñecos mecánicos y se mostraron inquietos y felices con auténtico nerviosismo, demostrando así unas ansias terribles de probar las libaciones y viandas allí presentadas.

—He visto una variedad terrible de bebidas en las mesas. Cloboberta me ha recomendado el Ribadesella Dry, aperitivo que por estos lares hacía furor hace siglos – dijo alborozado Mur-Alkami. Y creo que voy a probarlo junto con esos sintetizados taquitos rojos de cualidad porcina.

—A mí Epigmenio me ha recomendado un Sour Campari, eso sí, con un chorrito de ginebra. Creo que estará delicioso – apuntó con pompa plena de emoción Gutiérrez de Barnaul.

—Eso también para mí, qué pinta tiene – con vivos gestos se dirigió Salocín a Clodoberta, fiel encargada de realizar la petición al improvisado servicio del aperitivo terrícola.

El hombre de graciosos ojos saltones y según dijeron de nombre Ecotidio, que portó con diligencia las consumiciones, les dejó cosa por cosa pausadamente en la mesa y les sonrió a la vez que pronunciaba un sonoro “bienvenidos”. Con los primeros sorbos el ambiente se hizo abiertamente eufórico salvo para el líder de la expedición marciana, el comandante Nemos, que sosteniendo su rostro entre sus manos, en clara actitud pensativa, tenía su mente en otra parte de seguro fuera de aquel jolgorio. Fue entonces que Epigmenio preocupado intentó saber de sus cuitas :

—Mi dilecto comandante Tolstar, ¿ hay algo que encadene su mente ?
¿ Alguna tribulación que le subleve ? …

—En verdad sí, mi atento Epigmenio; estoy ansioso por bajar el material de laboratorio de la Ramsés y empezar a trabajar en el protocolo que venza al virus Luzbel – afirmó Tolstar pareciendo salir de una rueda inacabable de pensamientos oscuros -. Allí en Barnaul deben estar muy angustiados en estas inciertas horas …

—Casi a un tiempo de acabar las palabras de Nemos, el cielo se nubló repentinamente. Los sedentes todos miraron hacia arriba y no vieron ninguna nube o cosa parecida. Un profundo silbido se escuchó en la hondonada del valle, continuo y profundamente desazonante. Ninguna nube podía provocar aquel efecto. Más bien era una gran mole de índole metálica que se aproximaba a la inmensa llanada, acercándose más y más. Un anagrama se hizo más y más claro, al lado de lo que parecía una gran paralepípedo sobresaliente, de la gran estructura en sombra : una como cornamenta de res sobresaliendo de una coraza galáctica – de las usadas en el planeta azul por los guerreros escandinavos, muchos sextones atrás - y todo ello coronado por sendas hojas de laurel.

—¡ Sapristi ¡ – dijo sorprendido y con los ojos muy abiertos Tolstar –. ¡ Es la Viking del comandante Vadik Magadan ¡

 

 

 

CAPÍTULO XVI

Los comensales miraron al enorme monstruo volante, con evidentes muestras de inquietud. A sus rostros afloraron diferentes muecas y gestos, que manifestaban el estado emocional que vivía cada uno de ellos: Expresiones de estupefacción, en unos; y de pánico, en otros. En la mayor parte de los casos, los ojos eran albercas penetradas por el horror, que amenazaban desbordarse en una incipiente tormenta de lágrimas, el arrebol de las mejillas se había convertido en lividez de luna menguante y las bocas abiertas eran como tumbas profanadas que escondían una lengua abarquillada y muda. Aunque, por otra parte, no eran pocos los que perfilaban en sus labios una sonrisa bobalicona, una mueca de estupor, que no era sino un síntoma inequívoco de su estado de idiotez o inconsciencia, probablemente como consecuencia de los efectos del alcohol.

Todos permanecían sentados, en pose de estatua, con la espalda apoyada en el respaldo de la silla y los brazos sobre la mesa. Todos se vieron sorprendidos por aquella descomunal nave, que acababa de detenerse, justo sobre la superficie de la explanada donde se hallaban, a unos 1000 metros de altura en línea vertical. Todos, en menor o mayor medida, revivieron la pesadilla del holocausto nuclear de la noche anterior al sueño programado de cientos de años, y la angustiosa huída del exterminio en el vientre salvífico de una burbuja de crionización.

Epigmenio fue el primero en reaccionar. Retiró la mirada de aquel “Fénix” de la incertidumbre, y la dirigió hacia Nemos Tolstar, que estaba sentado frente a él. Lo observó con curiosidad y, al mismo tiempo, con indisimulada gravedad. Éste continuaba ausente. Ocultaba la cara con las manos, como si pretendiera esconderse en ellas, como un niño que intenta esquivar la realidad, refugiándose en las sombras de los párpados cerrados; y parecía no querer ser testigo del excepcional fenómeno que acontecía en el cielo del Valle de los Caídos.

Aguardó unos minutos a que el comandante depusiera su sorprendente actitud, y arrostrara los hechos con un talante más acorde con su condición de militar; pero Nemos Tolstar seguía enajenado en las tinieblas de la desolación y el abatimiento, circunstancia ésta, que no acertaba a comprender el amoscado Epigmenio.

—¿Quién es Vadik Magadan?, le preguntó.

Las palabras de Epigmenio le llovieron a Nemos como afilados cuchillos que cortaron las alas protectoras del silencio y de la noche del búnker de sus manos, en el que pretendía procurarse abrigo, y se le clavaron en los tímpanos, como dardos envenenados que reverberaban en ecos de sospecha.

—Vadik... Vadik..., balbuceó al fin.

—Sí, comandante Tolstar, ¿quién es?

—El comandante en jefe de la expedición marciana a la Tierra.

—¡Vaya! Entonces, usted...

—Ya se lo dije. La PATHFINDER, la nave nodriza de la cual soy el comandante, es la nave de avanzadilla de la operación destinada a encontrar el remedio, que sirva para combatir al virus que asola el planeta Marte.

—Ya. Y, ¿hay más naves?

—Sí, en total somos tres.

Epigmenio observaba a su interlocutor con cierto recelo. En realidad, le embargaban las dudas, acerca de las intenciones y el verdadero objetivo de los marcianos. Y en su ánimo comenzó a planear la sombra de la desconfianza.

—¿Por qué me ha ocultado la existencia de otras naves expedicionarias, Nemos? ¿Por qué no me ha puesto al corriente de su verdadera situación? ¿Hay algo más que deba saber?

—No, Epigmenio, no. Créame. Entiendo su desconcierto por la rapidez con que se suceden los acontecimientos. Pero, no tema. Todo está en orden.

Los dos hombres volvieron a guardar silencio, e inconscientemente, de un modo reflejo, centraron la mirada en la nave VIKING, que permanecía en posición estacionaria allí, en las alturas, majestuosa, esplendente, brillando con un fulgor metálico.

Vadik Magadan no daba crédito a lo que estaba viendo en la pantalla del monitor holográfico. Ciertamente se trataba de una estampa insólita. Junto a él, en la cabina de mando, estaba el oficial Al-Yakin, también muy sorprendido. Ambos contemplaban atónitos aquella extraña escena: un número indeterminado de hombres y mujeres, todos ellos cubiertos con una túnica azul, sentados en grupos alrededor de diferentes mesas, miraban hacia arriba. No se movían, no hablaban, ni tan siquiera parpadeaban. Solamente miraban hacia arriba.

A ninguno de los dos le pasó desapercibido el hecho de que la mayoría de aquellos individuos casi la totalidad, fueran lampiños. Nemos, en su última comunicación con la nave VIKING, ya le había informado a Vadik del tratamiento radioterapéutico al que se hubieron de someter los seres humanos terrícolas, para combatir las consecuencias letales del virus LUZBEL; pero, a pesar de ello, no cayeron en la cuenta de que la calvicie de éstos pudiera ser un efecto secundario derivado de dicho tratamiento.

Con todo, no obstante, esta curiosa circunstancia fue determinante para descubrir en aquel solar atestado de estatuas sedentes, a los integrantes de la tripulación de la nave PATHFINDER.

Vadik amplió la imagen de la pantalla, y recorrió con la mirada las distintas mesas. Advirtió que, entre tanta testuz pelada, destacaban seis cabezas adornadas con una notable pelambrera. Eran ellos. ¡Por fin los habían encontrado! Inmediatamente distinguió al comandante Nemos, y a Gutiérrez de Barnaul, y a los demás, uno a uno. Por su parte, Warran Al-Yakin se fijó, afectado por un estremecimiento que hizo que le temblaran las piernas, en la cara, desencajada y trémula, de Emil Salocín.

—Ahí están, Warran. Creo que celebraban algo.

—Sí, ¿quién sabe?

—¡Vaya aspecto más ridículo que tienen! Parecen fantasmas con hábitos azules. ¿Por qué vestirán esa indumentaria?

—No lo sé.

—Enseguida desentrañaremos el misterio.

Efectivamente, el comandante Magadan activó el circuito interno de comunicación, y reclamó la presencia del primer oficial Jenz Rosen en la cabina de mando. Y, una vez que éste se personó en la misma, trasladó a los dos oficiales su decisión de aterrizar en la inmensa plaza que divisaban en la pantalla de visión panorámica. Después, les transmitió las órdenes pertinentes, para llevar a buen término la operación.

—Usted, oficial Al-Yakin, reúna a cuatro hombres y disponga los preparativos para la puesta en marcha de la lanzadera ODÍN.

—¡Sí, mi comandante!

—Usted, oficial Rosen, tomará el mando de la VIKING, una vez que el oficial Al-Yakin, los cuatro hombres que haya elegido y yo mismo partamos a bordo de la nave ODÍN.

—¡A sus órdenes, señor!

El comandante Magadan y el oficial Al-Yakin salieron del cubículo de mando, y se dirigieron a los hangares del área reservada a la tecnología nuclear. Allí hicieron inventario del utillaje científico y militar que iban a necesitar para la acción que querían emprender. Luego, abandonaron este área, y avanzaron hacia la zona de avituallamiento, donde se hallaban las despensas de alimentos y drogas.

Cuando terminaron la relación de provisiones, materiales, instrumentos de laboratorio y artefactos y armas de guerra, Magadan encargó al oficial la misión de coordinar la actividad relacionada con el pertrechamiento de la nave ODÍN, además de precisar las instrucciones para su puesta en marcha. Y él se retiró al departamento del área de descanso, que hacía las funciones de dormitorio y receptorio particular. En este lugar esperaría hasta la hora de partida, 60 minutos más tarde.

 

 

CAPÍTULO XVII

¿Todo está en orden? ¡Mecágüen lo barrido! ¡Con lo grande que es el universo! ¡Vadik! ¡Solo sabes seguir mis pasos y aprovecharte de mis esfuerzos. Ornella tenía razón. Pero esto se va acabar.

Calma, controlemos la situación. Debo recuperar la confianza de Epigmenio, de forma que consiga neutralizar, ¡ES DECIR DESTROZAR, PULVERIZAR, VOLATILIZAR! a Vadik. Calma, calma.

—Caro Epigmenio, Vadik es un miembro principal del Consejo de Notables de Marte y, por añadidura, mi concuñado. Sé que debiera haberle puesto al corriente de la inestabilidad política que ha generado la epidemia de Luzbel en Marte, pero admitirá que las últimas horas han sido… excepcionales para todos nosotros. Por ello, le propongo que mantengamos una entrevista al más alto nivel…

—¿Al más alto nivel?

—…Sí, Ud., Vadik y yo. Para valorar las repercusiones sociopolíticas que generará la… reactivación del tráfago interplanetario.

¡Jesús! Ya empiezo a desbarrar yo también.

La algarabía de la merienda campestre contrasta con la frialdad de la mirada de Epigmenio. El afectuoso anfitrión se ha convertido en el hombre calculador que se acostó en una cámara refrigerada a pasar una noche de siglos. Calla y mira fijamente a Nemos.

Este tipo es muy peligroso. Detrás de esos ojos de gato y de sus ronroneos hay una manada de lobos. Cuidado Nemos.

Pausadamente, acariciando los cabellos que aún imagina sobre su reluciente calva, recobra su expresión afable.

—Entiendo.

—Edvoldo. Llegan nuevos amigos. Prepara unos sillones a la sombra, junto al altar mayor, para que podamos hablar tranquilamente. Cuando aterricen, pide al Comandante…

—Magadan.

—… que te acompañe hasta allí. Él solo. ¡Ah! Ahora no es necesario ningún refrigerio.

En cuanto a Ud., mi enigmático Comandante, ¿qué le parece si nos acercamos al sosiego del arca? Para que pueda describirme los recovecos de la política marciana, que tan misteriosamente ha ocultado hasta el momento.

—Con sumo gusto, Epigmenio.

…………………………………………………………………………………………

Los pasos de Vadik Magadan suenan femeninos en la quietud del templo e interrumpen el contubernio

—¿Qué tal estás, Nemos? Tienes un aspecto tranquilo. Me extrañó un poco que fuera Mur-Alkami quién me pusiera al corriente de los últimos acontecimientos, por un momento pensé que los torpedos positrónicos habían servido para algo, pero ahora aprecio que estabas ocupado en más importantes menesteres, que parecen orientados a la mejora de nuestra asociación.

—Epigmenio, permítame presentarle al Comandante Vadik Madagán…

—Magadan. Controla tu dislexia, Nemos.

—…vicepresidente del Consejo de Notables y responsable de la expedición a la Tierra en busca de la secuencia de ADN de Luzbel.

—Bienvenido, mi agresivo Comandante…

—¡Oye Nemos!, no me toques más los cojones…

—Descansa, Vadik. No es teatro, él habla así.

—Disculpe, Epigmenio, pero Nemos tiene una forma de ser que me hace pensar que se burla continuamente de mí.

—Le comprendo mi iracundo Comandante, le comprendo y comparto su opinión sobre nuestro amigo, pero ha de admitir que tiene una gran capacidad de adaptación al medio que le rodea, que nos resultará muy beneficiosa.

—¿Beneficiosa esta alimaña?; venenosa debiera decir. Le aseguro que al Adán de los Nemos le creó Dios a partir de mocordos de perro.

—No se altere, mi blasfemo Vadik. Deje que me explique. Nuestros objetivos, como seres humanos, son: mantenernos como especie y organizar una sociedad estable. Por consiguiente, debemos acabar con los mioritas, sí, ¿pero qué hay sobre lo que ocurrirá después? Es imprescindible vertebrar los contactos entre los terrrestres y marcianos, aportando cada cual sus mejores cualidades y repartiendo inteligentemente los resultados del proceso entre las personas adecuadas.

—¡Caramba, Epigmenio!, es ud. un maestro del eufemismo, pero no acabo de encajar en su lugar al comandante Tolstar, pues es evidente que yo cuento con las naves y el armamento necesario para acabar con los mioritas y ud. dispone del personal y del apoyo logístico imprescindible. También está claro el reparto del botín: para mí Marte y para ud. la Tierra.
—Pero, ¿Nemos? ¿Qué ganarías con tu participación en este nuevo triunvirato?

Vadik, eres el ser más obtuso de la creación. Lo ganaré todo. La Tierra, Marte, la Gloria y el paso a la posteridad. Seré el nuevo Cesar del Sistema Solar.

—El resto del universo. El control de las comunicaciones y del comercio entre Marte y la Tierra, quizás con base en la Luna, para evitar las suspicacias de ninguno de vosotros.

—Muy creativo, mi astuto Comandante, pero le queda por mostrar como se va a ganar tan altos dones. No quisiera ofenderle pero su tripulación parece sacada de alguna vieja película en dos rollos de Mack Sennet.

¡Alma cándida! Esa tripulación tan cómica, en este momento, se está pasando por la piedra todo lo que se mueve sobre dos patas en tu arca y yo me haré un llavero con tus cataplines, en cuanto acabe todo este asunto.

Nemos se yergue en su sillón y saca el fonostrón de su funda.

—Sé donde están los mioritas, cuantos son y como acabar con ellos.

Vadik y Epigmenio se miran asombrados. Mientras, conecta el fonostrón en posición manos libres y proyecta a dos mioritas holográficos que, a contraluz de la puerta del templo, mantienen una conversación traducida simultáneamente al europeo estándar.

……………………………………………………………………………………………..

—¿Cuántos de los nuestros están despiertos

—Somos 20 en Ryléh. Cinco en Shogoth y tres en Azath.

—No es suficiente. ¿Y en criogénesis?
—Entre las tres ciudades unos 12.000. Ya sabéis que el ataque nuclear humano mató a cien mil de los nuestros al cogernos desprevenidos.

…………………………………………………………………………………………

—Interesante, ¿verdad?. 28 mioritas con nombre y apellidos, que disfrutarán de la atención personalizada de “nuestro” equipo de asesinos, cuando estén descuidados, relajados, inofensivos.

—¿Qué equipo de asesinos, sangriento Comandante?

—El que empezaremos a preparar esta misma tarde, de manera que en un mes habremos acabado con esta plaga y podremos hacernos cargo de nuestros respectivos “negocios”. Sin guerras, sin daños laterales, con la eficacia propia del ser humano en esta elegante ocupación: matar a seres indefensos.

—¿Cómo has conseguido esa grabación?

—Creí que no me lo preguntarías nunca, Vadik.

Una delicada araña doméstica se mueve cosquilleante sobre la palma de la mano derecha de Nemos, que la acerca al rostro de su familiar político.

—¡Mierda! ¡Un ojo de Argos!.

—¿Otra vez le ha atacado la ira, mitológico Comandante?. Solo es una araña y me alegra comprobar que aún existen en Marte. Cualquier bicho será de gran ayuda en la repoblación del planeta, ya que, aunque en el arca tenemos el material genético correspondiente a todos los seres vivos antes de la guerra con los mioritas, el trabajo de generar los clones será ímprobo.

La cara de Vadik se contrae, sus ojos se cierran, sus dientes rechinan, su tez se vuelve berenjena. Gruñe y sopla hasta que recupera el control sobre sus manos, deseosas de estrangular al depilado triunviro.

—No es una araña. Parece una araña, pero es una subestación de espionaje micronizada autónoma SEMA 21. ¡Carajo Nemos! Eres un traidor y un ladrón. Este modelo no debía ser distribuido fuera del ámbito presidencial.

Nemos asiste sonriente a la pasión de Magadan, deleitándose en los primeros estadíos de su venganza.

—Ya lo sé, Vadik. Es muy peligroso que gente sin escrúpulos maneje estos aparatos, los personajes públicos podrían ser extorsionados fácilmente. Sin ir más lejos, ayer mismo he procesado las imágenes de un viejo verde que era sodomizado por un muchachito de melena leonada. No te puedes imaginar qué gemidos de placer. Era algo indecente.

Vadik se desploma, entre alaridos de rabia y de dolor, ante el asombro de Epigmenio y la satisfacción de Nemos.

—¿Qué les ocurre a Uds, los marcianos, mi tecnológico Comandante, con los asuntos aporculadores? Tampoco era algo tan desordenado, lo que estaba contando, para que su concuñado se pusiera así. ¡Ayúdeme que se nos muere!

—¡Petrikilo! Acuda a la cripta con un equipo de reanimación. El Comandante Madagán ha sufrido un infarto.

 

CAPÍTULO XVIII

Las imágenes que se proyectaban en la retina de Vadik llegaban a su cerebro teñidas de un halo rojo. La furia que invadía su flujo sanguíneo le había dejado paralizado, sus músculos petrificados, incapaz de articular palabra. Le resultaba imposible controlar su propio cuerpo. Un líquido tibio le resbalaba por la comisura de los labios cada vez que intentaba hablar, expresar verbalmente el odio que la rastrera actuación de Nemos le inspiraba. En aquel momento sólo su mente, fría y calculadora, funcionaba, a pesar del velo de ira que la envolvía. Fue ese segmento controlado de su cerebro el que se percató de la sigilosa retirada de Epigmenio del lugar en el que ahora se apelotonaban Petrikilo con su equipo de primeros auxilios y los cinco hombres de la Odín, dispuestos a proteger a su comandante. Con una sonrisa arrogante y estúpida Nemos se solazaba de su triunfo. Cruzado de brazos parecía no esperar otra cosa que un fatal desenlace de un momento a otro. La guinda inesperada de la muerte de Magadan significaría la coronación final de su propia persona y el éxito de su plan de dominio.

Poco a poco la parte lúcida de Vadik fue recobrando el control de todas sus facultades después del ataque de indignación que las imágenes de su encuentro con Warran le habían producido. Sí, Nemos era un imbécil. Ahora lo tenía claro. Y además un inconsciente por poner de manifiesto delante de los terrícolas sus diferencias.

—Vaya, vaya, Vadik. Parece que de ésta no te mueres.

Una mirada de atroz repulsión atravesó a Tolstar. Vadik se incorporó sobre su brazo izquierdo, ayudado por un siempre solícito Al-Yakint. Extendió su brazo derecho y señalando con un dedo acusador a Nemos, ordenó a sus hombres:

—Oficiales, detengan al Comandante Tolstar. Ha cometido un delito de alta traición. Trasládenle de inmediato a la Odín.

Nemos lanzó una risotada un punto histérica.

—Vadik, te recuerdo que en la base de datos de la Ramsés tengo una copia de tus andanzas. Una palabra mía y Mur-Alkami fonostrará la grabación a Marte. Tu mujer estará encantada de verte folgando con ese hermoso jovencito.

Vadik se sintió enrojecer de nuevo, avasallado por un odio voraz hacia el tarado de Nemos. Aquel tipo era realmente incombustible, se dijo.

Magadan se irguió por completo y tomó el fonostrón portátil de su cintura.

—¡Oficial Rosen! -gritó.

—¡Sí, señor! –surgió del aparato la voz grave del oficial al mando de la Viking.
—Oficial Rosen, destruya de inmediato la lanzadera de la Pathfinder. Hágala saltar por los aires. ¡Ya! ¡Es una orden!

—Pero, señor, los sensores detectan actividad en su interior.

—Lo sé. Seguro que es ese puto gordo pomposo de Mur-Alkami. Haga fuego y no me discuta.

—¡A sus órdenes, señor! –graznó, nervioso, Rosen.

De inmediato un horrísono estampido reptó hacia el interior de la caverna. Bajo sus pies una sutil vibración les confirmó que las instrucciones del comandante Magadan habían sido cumplidas.

El rostro de Nemos se tornó de una palidez lunar a la vez que su mano derecha empezaba a temblar espasmódica. Vadik dejó asomar a sus labios una sonrisa lobuna

—¿Sabes, Nemos? Eres un gran científico: jamás lo he puesto en duda. Pero como estratega eres un asco. Además Mur-Alkami siempre me cayó mal. Era un pedante insufrible con sus ceremonias del té y sus composiciones florales. ¡Esposadle!

Era increíble, pero aquel tipo le terminaba sacando siempre de sus casillas. Se había hecho el firme propósito de establecer un estado de cooperación con Nemos. Debían luchar juntos contra la plaga y dejar sus rencillas a un lado. Pero aquel botarate le exasperaba de tal manera que le resultaba de todo punto imposible controlarse. Ahora disponían de menos medios materiales para la misión y había resultado muerto el primer miembro de la expedición.

Las admoniciones autoacusatorias de Vadik fueron interrumpidas por una potente voz que parecía surgir espectral desde lo más alto de la bóveda de la cripta.

—Mis muy agresivos comandantes… –retumbó en un eco sordo la voz de Epigmenio.

En un acto reflejo todos los rostros se elevaron como en una plegaria hacia lo alto de la cueva. En cinco niveles diferentes de altura de la cúpula habían surgido unas atalayas que bordeaban el completo de la circunferencia. Y en cada nivel unos cien hombres uniformados de aspecto amenazador apuntaban sus armas hacia los marcianos. Quinientos sonidos metálicos simultáneos les hicieron comprender que otros tantos proyectiles estaban dispuestos a partir de sus engrasados alojamientos y acabar con sus vidas. Parecía oportuno e inteligente deponer cualquier actitud agresiva y atender a las palabras de su etéreo anfitrión.

Nemos fue sin duda el más sorprendido por aquella inesperada transformación. Los resucitados del Arca no eran sólo un grupo más o menos pintoresco de estudiosos, científicos y acólitos. De hecho parecían bastante peligrosos, al menos aquellos que ahora, como gárgolas hieráticas les apuntaban con sus bocas de fuego.

—Mis agresivos comandantes, –repitió la voz de Epigmenio- les ruego depongan sus belicosas actitudes.

Un grupo de soldados surgió de una de las galerías laterales para controlar más de cerca de los imprevisibles marcianos.

—Estoy desagradablemente sorprendido, caballeros. Han cruzado millones de kilómetros de vacío estelar para ponerse a discutir como infantes, repartiéndose el Sistema Solar como si fuera su finca particular. Señores, tengo la impresión de que sus cerebros no rigen como debieran. ¿Creen acaso que es el momento de chantajes? ¿Creen que deben solventar sus rencillas personales ahora, cuando su mundo agoniza y el nuestro puede que se encuentre de nuevo bajo la amenaza de los mioritas? –habló Epigmenio con indignación creciente.

—No hemos salido de nuestro sueño de mil años antes del momento señalado –continuó Epigmenio- para contemplar cómo dos individuos con sus facultades perturbadas por las drogas se dedican a arrojarse a la cara sus trapos sucios. ¿Dónde han abandonado ustedes sus responsabilidades? ¿Están locos? ¿Piensan que los mioritas se van a quedar tan tranquilos, esperando a que vayamos a sus ciudades a exterminarles? ¿Es que no me expliqué con claridad, comandante Tolstar, acerca de cómo y de lo que son capaces los mioritas? Por cierto comandante tengo una pregunta que me gustaría contestara. Sin falsedades ni medias verdades, por favor.

Nemos miró en todas direcciones. Sus ojos dieron en cruzarse con la mirada de Vadik. Aquellos ojos azules, gélidos le lanzaban un aviso. Nada de añagazas esta vez, Nemos, parecían decirle, que la cosa está muy jodida.

Tolstar carraspeó y se dirigió hacia algún lugar indeterminado de la bóveda.

—Dígame, amigo Epig.

—Querido comandante Tolstar, no me toque más los cojones –se irritó Epigmenio. Déjese de huevonadas que las circunstancias han cambiado. Por cierto, mi verdadero nombre es Trebor Sangar, Comandante en Jefe del Ejército de la Unión Europea. O de lo que queda de ella –susurró con un punto de melancolía el nuevo Epigmenio aquella última frase.

—Jolín, Vadik, ¡como tú! ¡Comandante! –rió Warran en el oído de Magadan.

Vadik le fulminó con la mirada. Al-Yakint consideró oportuno no volver a abrir la boca.

—Está bien, general Sangar –respondió Nemos aún sorprendido por el cambio operado en su antiguo anfitrión. ¿Qué es lo que desea saber?

—Dígame, Nemos, ¿cómo lograron conocer la localización de la ciudad miorita? ¿Y cómo introdujeron allí el ojo de Argos?

Nemos se rascó el cogote con dificultad, esposado como estaba. Miró a Vadik, pero ése esquivó el encuentro con sus ojos con un giro de la cabeza, en un gesto que podría haberse traducido con un: “Ahora apáñatelas como puedas, traidor”. Tolstar pareció haber entendido el mensaje subliminal, porque de inmediato, levantando la voz, dijo:

—No puedo responder a esa pregunta, general Sangar. Sería alta traición. Mi superior, el comandante Magadan, podría ordenar mi ejecución sumaria. Además, él también conoce los principios del SEMA 21. De hecho él fue uno de los científicos que lo desarrollaron.

Vadik no podía salir de su asombro ante la desfachatez de aquel individuo.

—Pero… Serás hijo de puta… -le espetó a Nemos mientras daba, amenazador, dos pasos hacia él. La voz tonante de Sangar contuvo su primer impulso agresor.

—Cálmese, comandante Magadan. Desde luego, señores, para tener ustedes más de seiscientos años según me han contado, se comportan como críos.

La voz de Epigmenio se elevó de tono y ordenó:

—Soldado Giscard, ejecute acción disuasoria número uno.

Un estampido resonó sobre los muros de piedra de la cripta. De forma simultánea un surtidor de sangre, hueso y cartílagos manó de la rodilla izquierda de Nemos. Entre aullidos de dolor éste se derrumbó como un fardo sobre las frías losas de mármol que rodeaban la entrada al Arca subterránea.

Vadik, cada vez más superado por el curso de los acontecimientos, musitó para sí una antigua salmodia que quería traducir en una breve frase la hipotética locura de Epigmenio.

—Joder, este tío está como una puta cabra.

—Soldado Giscard –tronó de nuevo el general Sangar- ejecute acción disuasoria número dos.

—Alto, alto, general, deténgase, por favor –gritó en agónico graznido un Vadik desesperado. Yo contestaré a su pregunta.

—Cobarde… -musitó entre gemidos de dolor Nemos.

—Cabrón… Liante… –le devolvió Vadik el cumplido.

—Estoy esperando, comandante Magadan.

—General Sangar, el ojo de Argos es un organismo cibernético capaz de rastrear sistemas orgánicos inteligentes…

—Muy interesante, comandante. Prosiga.

—Poco más hay que decir, general. Los SEMA 21 fueron desarrollados con una doble función: la búsqueda de vida inteligente y…

—Cuéntalo, cabrón. Reconócelo –surgieron las palabras de Nemos desde lo más profundo de su agonía.

Vadik crispó su mandíbula, pero consiguió reprimir la respuesta que le bailaba en los labios en justa represalia a la obstinación autodestructiva de Tolstar.

—…Y el control de los ciudadanos, general. Aunque lo cierto es que hasta la llegada del virus Luzbel no nos vimos en la necesidad de emplearlo en este último sentido.

—Es decir, comandante, si deduzco bien, su compañero Tolstar ha espolvoreado el planeta con estos instrumentos y algunos de ellos han conseguido sobrevivir lo suficiente como para enviar informes sobre las localizaciones de las ciudades mioritas.

—Deduce bien, general –gruñó Vadik.

—Dígame Tolstar, ¿de cuánta información dispone al respecto?

Nemos permanecía en posición fetal, acunado por el mármol de la cripta. Sus manos ensangrentadas sujetaban su rodilla herida. Al oír su nombre descendiendo desde lo alto de la cúpula dio un respingo y se incorporó parcialmente.

—Comandante Tolstar, ¿sigue con nosotros?

—Sí, sí, señor… -balbuceó

—¿Y bien?

—Lo que han visto. El ojo de Argos tiene una vida limitada, por desgracia. En realidad sólo conocemos la localización de Ryléh y el fragmento de conversación que han podido contemplar. No sabemos dónde se encuentran las otras dos ciudades mencionadas.

—¿Dónde se halla Ryléh? –inquirió Trebor Sangar.

—En el Atlántico Sur, en algún punto de la costa cercano a la antigua ciudad de Río de Janeiro. De hecho la señal que detectamos con origen en el Valle, venía fusionada con otra emitida desde aquella ciudad. Hasta que recibimos la información del ojo de Aros pensamos que allí existía otra Arca como la de ustedes. Ahora ya no lo tenemos tan claro. ¿Saben si allí hay o hubo otro refugio humano?

La lápida que descansaba delante del altar empezó a elevarse con un sonido siseante. En la nube de luz blanca que acompañó el silencioso deslizar de la losa se materializó el general Sangar. Había abandonado ya su túnica y sus maneras sacerdotales para convertirse en lo que había sido antes del gran sueño. Y en lo que debía ser a partir de ahora: un aguerrido militar dispuesto a salvar a la humanidad. Tenía perfectamente clara su misión y la cumpliría aún a costa de aquel par de desequilibrados.

Antes

Epigmenio pulsó un panel disimulado en la roca viva que tapizaba el interior de la cripta del Valle y desapareció de la escena que estaba teniendo lugar ante sus atónitos ojos. Al otro lado le esperaba su ayudante, el teniente Stuart Anderpotor, el mismo que había compartido lecho unas horas antes con el insaciable Salocin. Sus rostros denotaban la extrañeza y confusión que les había causado el curso de los acontecimientos. Epigmenio se quitó la túnica y la arrojó con desdén a un lado. A continuación se enfundó en su uniforme de general.

—Resulta increíble, teniente. Vienen desde Marte. Creemos que son nuestra última esperanza. Su planeta está muriendo a causa de la misma plaga que nos asoló a nosotros hace seiscientos años. Los mioritas siguen campando por ahí fuera, de hecho son ellos los que han provocado la crisis en el planeta rojo. Y estos tipos se ponen a repartirse el Universo delante de nuestras narices. No sé que pensar, teniente Stuart, estoy desconcertado. Tanta amabilidad con Tolstar pensando que era un líder de su mundo y resulta ser un traidor en fuga. No sé… No sé…

—Señor, la esencia de lo que conocemos debe ser cierta. Al menos de igual forma me lo transmitió el oficial marciano Salocin, aunque concuerdo con usted en que el comportamiento de los comandantes resulta, cuando menos, un tanto esquizofrénico.

—Sí, eso parece. Quizá debieran leer menos a Plutarco y los clásicos y dejarse de triunviratos y repartos de imperios y guerras civiles. ¡Tenemos a los bárbaros a las mismas puertas de Roma!

Una potente explosión interrumpió las reflexiones de Trebor Sangar. Varios monitores se iluminaron en la sala donde se hallaban y comenzaron a emitir imágenes de lo que estaba sucediendo. Una escena nebulosa, confundida entre retazos de humo negro y espeso apareció ante los ojos de los militares terrícolas. Un joven con la túnica desgarrada y su rostro tiznado se materializó en la pantalla.

—General…General…

—¿Qué ha ocurrido soldado?

—La nave marciana, la Viking, acaba de atacar a la lanzadera del comandante Nemos.

—Joder, pero estos tíos están locos de atar. ¿Bajas?

—Entre los nuestros ninguno, señor. Estamos regresando al interior del Arca, según el protocolo de emergencia.

—Correcto, soldado. ¿Y entre los marcianos?

—Había un oficial en la lanzadera, señor…Debe haber muerto… Un momento, señor…

El soldado se giró y durante unos segundos desapareció de la pantalla a la que Trebor atendía impaciente. Ésta se llenó de brochazos danzantes rojos y negros, humo y fuego, confusión de túnicas en movimiento hacia las entradas del Arca. El soldado regresó al monitor acompañado por un marciano con uniforme de cuero negro y rostro descompuesto.

—¡Oficial! –tronó Sangar. ¿Qué demonios ha ocurrido?

—Lo ignoro, señor –tartamudeó Mur-Alkami, nervioso, lanzando miradas inquietas a su alrededor.

—¿Que no lo sabe? ¿No era usted el oficial al mando de la lanzadera?

—Sí, pero había salido un momento…

—¿Abandonó su puesto sin permiso? –dijo incrédulo el general Sangar.

—Esto… Sí… Bueno, verá… Es que tenía ganas de cagar… Bueno, de defecar, quiero decir, usted me entiende… Y había leído, porque a mí me gusta mucho leer, sabe usted, sobre todo literatura japonesa, porque Kumiko y yo somos de ascendencia japonesa y a pesar del tiempo aún conocemos nuestro idioma original, digo que había leído, no sé dónde, creo que en algún libro de haikus japoneses, porque en Marte disponemos de una inmensa biblioteca digital, sabe usted y mayormente está todo lo publicado hasta que se produjo el Holocausto, ¿no?, y, claro, después poco se habrá editado… Le decía que el japonés éste, un tal Haruki Norigiri recuerdo ahora, decía, digo, que no hay mayor placer que cagar en medio del campo, con el airecillo acariciándole a uno las nalgas desnudas y los testículos penduleantes, con los tallos de hierba ondulando bajo tu perineo, rozándolo como al albur de los caprichos del dios Eolo… Y, claro, en Marte, lo que se dice cagar, cagar al aire libre, pues como que difícil, ¿no?, porque si te pones la descompresión como que te chupa los intestinos por el ano y notas como que los ojos se te salen de las órbitas, como a usted ahora, general, igual igual, que ya le pasó antes de la plaga a un conocido mío, lo del ano, digo, a Rellüm Eseam, que usted no lo conocerá, pero era famoso en Marte por sus ocurrencias sobre individuos marginales de la sociedad, como él mismo, que estaba un tanto perturbado el hombre y quizá por eso murió mientras cagaba…En fin, que no pude evitar la tentación… Y… Bueno, la verdad es que ya había acabado, lo que pasa es que después de tantas semanas sin mi querida Kumiko, que no sé lo he dicho antes, pero es mi compañera, toda una mujer, no se vaya usted a creer, con un cuerpo así como menudo y aniñado, pero de una fogosidad… Pues eso, que estaba aprovechando para… Usted ya me entiende…Aliviarme y eso…Y… Entonces la explosión me pilló con los pantalones bajados y en cuclillas y dedicado al asunto… Y no sé que habrá sucedido, porque yo soy muy cuidadoso y ordenado con todas mis cosas y…

Epigmenio contemplaba el monitor con los ojos desorbitados, petrificado, con la boca abierta, el belfo caído y la saliva corriéndole libre por la barbilla. Aquello no podía estar sucediendo. Se llevó las manos a la cara y ocultó su rostro entre ellas, reprimiendo sollozos e imprecaciones. Cortó la verborrea de aquel individuo y mirando a un dios invisible que pudiera habitar en el techo de la sala y comprender su situación, dijo para sí:

—Señor, Señor, ¿por qué no me calcinaste a mí también en el fuego nuclear? ¿Qué pesadilla es ésta?

Luego agitó su cabeza en un gesto que quería significar su vuelta a aquella caótica realidad.

—Teniente, ponga en marcha el operativo “Cúpula Cerrada”. Hay que instaurar el orden en este caos, de otra forma estaremos perdidos.

—Sí, señor.

—¿Continúa llegando la señal?

—Sí, señor, de forma constante.

Aquel era otro aspecto fundamental a tener en cuenta en los planes subsiguientes que debía elaborar. La señal interceptada, con origen en Río y destino en la Viking. Señal que sólo podía tener un emisor. Ellos. Los mioritas. Conocían la llegada de la Viking, pero, ¿qué querían? En la poderosa mente del general Trebor Sangar las piezas empezaron a encajar. Las naves marcianas y su potencia de fuego iban a resultar vitales en el cumplimiento de las maniobras que bullían en su cerebro.

 

 

 

CAPÍTULO XIX

Menudos pájaros son estos marcianos, pensó el General Sangar, abrumado por los interrogantes que se le presentaban para hacer frente al incierto futuro. Incierto por la diáfana amenaza de los mortillitas [según una de las numerosas acepciones precedentes; nota del multiautor] que estaba claro habían sobrevivido y no cejarían hasta barrer a la raza humana del planeta azul. Allí tenía a su merced a aquellos belicosos marcianos acuciados por sus ambiciones tanto como por el virus que asolaba la Colonia de Marte.

Vadik Magadan y Nemos Tolstar tuvieron que ser internados, muy a pesar del General, en los quirófanos del Arca del Valle de los Caídos. Los cirujanos, que algunos había en la recién nacida colonia tras la hibernación, se estrenaron tras largo tiempo de inactividad. A Vadik le operaron para realizarle los antiguos y efectivos “by-pass” que hicieron furor en el siglo XX en apenas dos horas de quirófano. Con el Comandante Tolstar tuvieron que ser más artesanos y tras la cauterización de la herida probaron una prótesis completa de rodilla, construida en titanio y carbono, que había dado unos resultados magníficos en los siglos XXII y XXIII. Tal era el éxito que no eran precisas otras técnicas ante cualquier disfunción de las articulaciones fuera por envejecimiento, accidente o herida por arma de fuego, como era el caso.

El General aprovechó la convalecencia de un par de días para hablar muy seriamente con ambos comandantes en la sala hospitalaria. Se puso de pie entre ambos lechos, y tras una larga y admonitoria mirada, les hizo saber que desde aquel momento estaban bajo su custodia y sus naves y pertrechos quedaban confiscados por el ejército de la Unión Europea. Los dos marcianos se ignoraban estando a escasa distancia sus camas con lo que el General tuvo que dirigirse a cada uno individualmente. Trebor Sangar les fue “franco”, existían dos únicas posibilidades : o aceptaban la reclusión en el Valle, custodiados por los soldados, o estaban participaban en los planes bélicos con el rango que ostentaban bajo su mando directo. El primero, Nemos Tolstar, sin apenas reflexionar, aceptó participar en la ofensiva contra los maoritas. El segundo en discordia, Vadik Magadan, aceptaría la reclusión con la única condición de tener medios para averiguar los secretos de Luzbel, el virus mortal que estaba asediando la ciudadela de Barnaul. El General aceptó la condición puesta por Vadik e incluso le garantizó cualquier ayuda técnica, humana o material para llevar a buen puerto la empresa.

Este diálogo fue a la mañana del día cuarto de estancia en el Valle de los Caídos. Por la tarde, Trebor Sangar recibió la visita de Nemos Tolstar para reafirmarse en su elección y para congraciarse con el General visto que era el que mandaba en la colonia del Valle.

¡ Este Trebor Sangar se piensa que soy un chalado sin noción de nada ! Claramente, ahora mismo me conviene ser un corderito a sus órdenes …luego ya veremos ¡

—Espero lo mejor de usted tras nuestro encontronazo inicial, mi rebuscado Comandante Nemos – hablaba Sangar – A propósito, ¿qué tal va esa rodilla? ¿Han trabajado bien nuestros matasanos?

—Formidable, diría yo. Me han dejado la rodilla como nueva porque la artrosis llevaba sextones hormigueándome y no era nada cómodo tener que infiltrarme cobaltotertulina cada mes – agradeció don Nemos con sonrisa cosmética a su, a regañadientes pero en fin benefactor.

—Quiero que cenemos juntos Comandante Nemos, usted y yo para preparar la estrategia del futuro –dijo Trebor Sangar -. Será una cena de trabajo con poco tiempo para el cachondeo. Ya me entiende, el horno no está para bollos y como nos distraigamos la hecatombe de la especie es algo inmediato. Ah, vendrán otros dos mandos militares del Valle, Anderpotor, al que ya conoce usted, y Chirirommel – apodado el Zorro de Sajonia - , uno de los militares intrépidos que ya hizo frente a los mortillitas antes del gran sueño. Hágame el favor de avisar también a su compañero el otro comandante barnaultarra. Ya está inmerso, según me han contado, en las pruebas radiactivas sin apenas haberse recuperado de la operación de la “patata”.

¡Coño, otra vez vuelve la burra al trigo! Y sobre todo tengo que decírselo yo, ahora que apenas tengo ganas de fonostrar con Magadán el Notable.
¡ Habrase visto, semejante cuadro !

—Bien general, me ocuparé de avisarle sin falta … - formuló con retintín, don Nemos.

—Muy agradecido, Comandante Nemos – sentenció Sangar amablemente.

A ver cómo le abordo al gracioso de los mocordos de perro, ahora que está embebido en las pruebas con el virus con ese Al-Yakint… Igual es una buen momento para que no se me suba a las barbas.

Entretanto, soldados del Arca ayudados por los Mur-Alkami, Yochbús, Petrikilo y compañía, habían viajado con la lanzadera Odín hasta la nave de Tolstar, la emblemática Pathfinder , y la habían recuperado para la batalla decisiva que se avecinaba. La gran explanada tenía un aspecto imponente pues se podían observar a la derecha de la ya nombrada nave, la Viking y la Mariner, de la flotilla al mando de Vadik, completando una gran flota de combate base para la búsqueda y la lucha contra los belicosos mioritas. Bajo la gran cruz había un hervidero de soldados y personal técnico. Los preparativos se podían comprobar por el constante ir y venir de hombres subiendo y bajando a las citadas naves y también, según se divisaba, ocupándose de la puesta a punto de las semiesferas artilleras de las imponentes máquinas interestelares. Había un gran movimiento seguro preludio de una gran batalla.

Caminaba entonces, el por todos denostado Tolstar, con ánimo insuperable, hacia las dependencias más interiores del Valle, allá donde estaban los laboratorios. Entró en el de más a la derecha, ocupado por Vadik y Al-Yakint, según se podía observar por la gran cristalera. En la imaginación de Tolstar, también con unas grandes y perspicaces dotes de científico, se aparecía de forma clara que estaban inoculando una cepa del virus traída en la “Viking”, en clones de lechones para después someterlos a radiaciones de Radón 114 con el objetivo de redactar el protocolo de curación. El clon de lechón había sido el gran suplente que había desbancado a los chimpancés en los laboratorios terrestres hacía ya bastantes sextones. Se creaban en el laboratorio de forma poco trabajosa con la ventaja de que comían de todo no como los simios que necesitaban de forma imperativa esa conocida fruta alargada y amarilla nacida al calor tropical.

¿A este fenómeno de Magadán qué tal le estarán saliendo los chorizos radiactivos? Parece que han achicharrado a unos cuantos lechoncillos sin haber conseguido todavía su objetivo. Qué perspicacia la mía.

—Buenas tardes, Comandante Magadán, si molesto vuelvo más tarde – interrumpió Tolstar.

Vadik y su compañero, ataviados con dos pesados petos antirradiación y gafas especiales se giraron para, levantando el rostro, clavar su mirada en los ojos veladamente risueños del visitante

—No hay caso. Ya nos tocaba beber un poco de colbaltoporfirina – dijo Vadik mientras Al-Yakint bajaba la cabeza en señal de desdén hacia el problemático visitante.

—Simplemente decirte que el General Sangar nos convoca esta noche a una cena de trabajo para preparar los planes de futuro. ¿Has fonostrado con Marte ya? – culminó preguntando a Vadik.

Este ya me la ha jugado. Lo noto en su mirada bovina. Me habrá puesto a bajar de un burro. Va a ser que sí. Lo veo en esos ojos de llenos de rencor.

—Por supuestísimo, Comandante , es lo primero que hice cuando salí esta mañana del área hospitalaria, eso sí, habiendo pedido permiso previamente al General Sangar, nuestro anfitrión – habló Vadik.

—Nos veremos entonces en la cena, Comandante Vadik – se despidió don Nemos.

Huele a gorrino achicharrado, qué asco. Esperemos que el menú de la cena no incluya variedades porcinas.

—Bien Comandante, allí nos veremos – respondió Vadik ante el aire ausente de Al-Yakint y las espaldas de Nemos que se dirigía tranquilamente hacia la puerta.

Hechas las presentaciones iniciales de Otto Chirirommel, que se cuadró con marcial sonoridad de choque de tacones, se sentaron a la mesa circular bajo una luz tenue que daba a la sala una acogedora ambientación. Llevaba el tal general un monóculo fuera de todo tiempo y lugar que le daba un aspecto curioso entre trasnochado y elegante y un bigotillo sospechosamente escueto y cuadrado. En fin, muy germánico. Por su parte, Anderpotor se puso farragoso con sus batallitas y Sangar le cortó sutil pero amigablemente, sin la usual frialdad castrense. Mientras bebían un rico vino dulce a modo de aperitivo, éstos fueron los diálogos que se sucedieron aquella noche :

—Creo que todos ustedes están al corriente de la situación ¿no?. El providencial ojo de Argos enviado por el Comandante Tolstar nos ha informado de dónde está el bastión mortillita de Río. Sabemos que por ahora son unos pocos en cada una de las tres colonias – recapituló Trebor Sangar y sin tomar aliento reanudó su discurso -. Nuestro macrocerebro cibernético del Valle, de nombre RYPL, está estudiando coordenadas terrestres para averiguar las dos localizaciones restantes donde se hallan escondidos nuestros enemigos. Esperamos que esta noche nos dé una respuesta concreta.

—Está claro que no conocemos el momento en que sacarán de su letargo a los miles de guerreros mioritas; pero seguro que lo harán en pocos días – agregó Vadik Magadan.

—Ante una fuerza de esas dimensiones nuestra flota no tiene muchas esperanzas – apuntó Nemos Tolstar.

La ayuda de cámara Clodoberta apoyada por Ecotidio trajeron unos entrantes coloristas : panaché de soja, vainas, brócoli y coles de Bruselas aliñado con un, dorado en su brillar, aceite de Jaén, de oliva claro, cecina de Toledo de un color rojizo muy atrayente, filete tártaro de perro chico y mollejitas de lechón rebozadas a fuego lento con una guarnición de lechuga y zanahoria.

El círculo de comensales estaba babeante ante tan colosal comienzo.

Madre mía, esas mollejitas ¿no provendrán de lechones achicharrados por el Notable Magadán?. Creo que no las voy a probar por si acaso.

—En mi opinión y conocidas las coordenadas de las dos restantes bases mortillitas – arguyó Vadik Magadan abriendo la charla estratégica – deberíamos programar una serie de torpedos positrónicos acompañados de unos ojos de Argos, con fines verificativos, de manera que los lugares habitados por ellos fuesen barridos de la superficie terrestre.

—Ni torrpedos positrrónicos ni potorrros. Eso es un plan peligrroso pues como muy bien decía santo Tomás, hay que verr para creerr – argumentó Otto Chirimrommel, el Zorro de Sajonia y prosiguió –. Hay que irr a los rrefugios subterrráneos de esas alimañas y exterminarrlas una a una sin ninguna conmiserración. Irr a las cunas de hiberrnación de esas miles de bestias del averrno y levantarr acta de que no ha quedado ninguna con aliento trras la cacerría. Mi experriencia del pasado así me lo dicta.

—De acuerdo General Chirirommel, pero estará de acuerdo usted que tenemos que movernos rápido para llegar a las tres colonias con la flota de combate o bien dividirla y asignar una nave de acecho a cada centro mortillita – apuntó con tino Anderpotor.

—Sí, cómo no, Anderrpotorr, ése es un matiz que debemos clarrificar conociendo que poseemos trrres herrmosas piezas de ataque que están siendo preparradas con mucho mimo para la operración en la explanada del Valle – apostilló Chirirommel.

—¿ Podría apuntar una idea, caballeros? – interrogó retóricamente Nemos -. Ya que tenemos una localización segura como es la de Río podríamos poner rumbo esta misma noche, después de acabar esta suculenta cena, en la Pathfinder mi tripulación y yo más algunos efectivos de la Colonia del Valle para buscar sobre el terreno a los mioritas de Río.

—Es una idea interesante… - manifestó el General Sangar mientras se daba cuenta del error que podía cometer al soltar la correa del cuello de Tolstar.

Siguieron charlando y comiendo con lo que los platos quedaron vacíos con asombrosa rapidez. El segundo plato fue un cocinamiento descollante : láminas de hojaldre con ventresca de atún todo ello cubierto con una salsa de chipirones. Los comensales esta vez prorrumpieron en exclamaciones de placentera sorpresa. Ecotidio y Clodoberta contestaron al júbilo reinante con una sonrisa y una reverencia de agradecimiento. Los apuntes estratégicos continuaron sucediéndose haciendo cada vez más claro el ataque inminente del día siguiente. Al acabar la cena y con la chispa del vino de Rioja de las bodegas del Valle, Vadik y Nemos se retiraron juntos a los aposentos de los visitantes. Aquel iba tirando al aire y recogiendo con su mano derecha la esfera azul como pasatiempo tranquilizador. Cuando ya se iban a despedir Vadik, pesaroso por los últimos y poco amistosos hechos acaecidos entre ellos dos, con los ojos lacrimosos, le dijo a un Nemos Tolstar completamente ebrio con acusados problemas de equilibrio :

—Mañana, en la batalla, piensa en mí.

 

CAPÍTULO XX

—Desespérate y muere- finalizó Vadik con media sonrisa chusca.

La Pathfinder se había convertido en una maquina de destrucción infalible. Un arsenal de torpedos positronicos abarrotaban sus bodegas. Equipos de asedio y invasión de fortalezas submarinas aguardaban prestos a ser utilizados. Tres vehículos de oruga tridimensional con lanzaderas láser y UV facilitarían el avance en la fortaleza. Un grupo de soldados bien entrenados y sumamente motivados esperaban en tensión dentro de la nave la orden del comandante en jefe de la misión, Nemos Tolstar. Se eligieron a los mejores: Rosen, Warran, Mur-Alkami, Salocin de entre el grupo de los marcianos y Chirirommel, Francisco Franco, Cocohuahua y Viriato entre los marcianos. Todo encajaba a la perfección menos ese mensaje proveniente de la fortaleza de Ryléh.

—Comandante, acabamos de captar un mensaje proveniente de una localización cercana a Río. Esta cifrado en una frecuencia inusual.- En su carrera precipitada Warran estuvo a punto de arrollar a Salocin que limpiaba su pistola de tiro curvo.

—Pues descífrela, so parvado. Aplique L´hopital y conviértalo en archivo pdf.- Salocin intentaba colocarse el diente que se había arrancado con su pistola. Warran tecleaba con descaro. Nemos tamborileaba con una mano y se manoseaba el finis barriga con la otra.

—Paso por el monitor el texto del mensaje:

“ Estimados marcianos:

Espero que al recibo de esta estéis todos bien, nosotros así lo estamos. Sabiendo de vuestra estadía aquí en nuestra querida tierra y siendo bienvenidos como sois, quisiéramos proponer un trueque que creo nos llenará de gozo a ambas partes. Como ya sabréis nosotros casualmente disponemos de la secuencia de bases de ADN del virus que inesperadamente fue a caer en vuestro planeta y que está causando tanto dolor, pues bien queremos ayudar a acabar con él. Os daremos la secuencia e incluso mas os daremos un antídoto sintetizado a partir de ella y además os lo cederemos gratuitamente, libre de cargos. Eso sí necesitaríamos que nos proporcionarais previamente una protección contra la radiación para poder salir de nuestro cubiculo.

Desgraciadamente razones históricas han conducido a un desconocimiento completo de la tecnología nuclear.

Esperando una pronta y satisfactoria contestación a esta, se despide atentamente,

Ct-Latho
Subrelator de la zona subatlántica”

—Acojonante, comandante. Habrá que aceptar sin demasiado pensar.

—Warran es usted un poeta cantamañanas. Pero tiene razón aceptaremos, les quitaremos el antídoto y los eliminaremos de la faz de la tierra.- Un reguerillo de saliva se escurrió de la comisura derecha de su labio aprovechando un ligero temblor del mismo.

—Por cierto, Warran. ¿Ha regresado Sagan con la Mariner de la captación de señales para el RYPL?

—No aun no y ya tardan. Déjeme que rastree la zona de destino.

—Bien. Infórmeme de lo que averigüe. Estaré en mi camarote. Voy a merendar.

Encima de la mesa solo unos restos de pan con chocolate y la cáscara de un plátano alrededor de la cabeza roncante del Comandante Tolstar.

—Comandante….

—Coño Warran, no le dejan a uno ni cavilar sobre la batalla.

—Es que tengo noticias inquietantes.

—Escupa.

—La Mariner ha sido destruida. No sabemos como. Y…como podrá suponer no hay supervivientes.

—¿Quiénes la pilotaban además de Sangar?

—Anderpotor y Giscard.

—¿El hijo puta que me disparó?

—Ese mismo.

—Cojonudo. De un plumazo me desembarazo graciosamente del insufrible Sangar y de sus esbirros más insoportables. Solo falta que Vadik se muera de peste porcina.

—No entiendo, mi comandante.

—Ni falta que hace, ni falta que hace. Mañana empieza la guerra. Salimos hacia Río. Que todo el mundo este preparado. A pesar de todo vengaremos a esos tres. Diana a las 5,45h.

—¡¿De la mañana?!

—No, de su puta madre. Cada día estoy mas convencido que tengo a mis órdenes un grupo de flechas. Aléjese de mi vista que me conozco.

La bruma que precede al alba cubría la zona del Arca, cuando la Pathfinder despegó orgullosa y segura de un regreso victorioso. Algún madrugador con un rollo de papel higiénico en las manos, aprovechó para despedirse utilizándolo. La madre de todas las batallas abría sus puertas.

—Comandante, estamos en la vertical del objetivo. Accionamos incertidumbre y pantallas protectoras.

—Warran conecte con esos bichos, proyécteles unos trajes antiradiacion y que salgan con el antídoto. Quiero ver las caras a esos marranitos.

Los dos trajes de que disponían en la nave fueron expulsados por una de las bocanas de los lanza torpedos y aterrizaron mansamente en las coordenadas solicitadas por los mioritas.

Dos de ellos asomaron por una grieta de un otero y se apresuraron a enfundárselos.

—¿Ha visto mi comandante? Tienen cuatro patas y ojos amarillos como de ictericia y son jodidamente feos.

—Si ya los he visto. ¿Qué esperaba encontrar debajo de la tierra sino monstruos? Vea llevan algo en las manos o en eso que parecen manos. Amplíe la imagen y digitalícela. Si lleva la secuencia encima lo sabremos antes de que se entere.

—Comandante ahí esta. Es muy sencilla: “CAGAGATACAGAACATAACATACATACA” y luego la otra hélice: “GTCTCTATGTCTTGTATTGTATGTATGT”.

—Ya son nuestros. ¡Disparad con todo a esas repugnancias!

De los dos mioritas solo quedó una sombra amarilla en el suelo. El otero desapareció bajo el fuego de la Pathfinder. Una especie de fortaleza subterránea apareció en el fondo del enorme agujero que otros tres torpedos se encargaron de hacer desaparecer. No quedaba nada. Repentinamente de no se sabe bien donde surgieron varias naves extremadamente pequeñas y rápidas.

—¿Qué coño es eso de color fucsia, Warran?

—Parecen naves de ataque ligero pero para un solo ocupante. ¡Están disparando!

Un rayo amarillo violáceo se emparejó a la Pathfinder y cuando llevaban la misma velocidad, embistió. Debilitando la protección en la parte de popa.

—¡Franco!. Informeme de los desperfectos que nos ha ocasionado el mosquito ese de mierda. Warran prepare los positronicos zigzageantes y explíqueme esto.

—Es un truco viejo, comandante. Lanzan proyectiles inteligentes. Se colocan en paralelo con el objetivo y cuando alcanzan su misma velocidad que entonces se aproxima infinitesimalmente a cero, pasando a ser infinitesimalmente desconocida por tanto localiza la posición e impacta sin error posible. Así se pasan a Heisenberg por el forro.

—¡Franco! Le he dicho que me informe. Este enano paticorto siempre va por su cuenta, se cree el dueño del mundo. Mur-Alkami acuda a ver que ha sucedido en popa.

—Aquí Franco. Daños menores en popa. La barrera protectora ha funcionado bien pero no creo que soporte muchos como este ultimo.

—Warran, necesito saber cuántos son y con qué defensas.

—En total son 18. Sus defensas son rudimentarias. Una granada fragmentadora se puede cargar 10 a la vez.

—Bien pongamos velocidad 0,8c. Situémonos justo delante de ellos y abrasémoslos con dos granadas en ángulos complementarios.

La Pathfinder maniobró velozmente y con precisión. Un suspiro y todas las naves enemigas se la encontraron de frente y con cara de pocos amigos. Dos detonaciones secas y el espacio se incendió. Solo quedaron 3 aparatos y dos de ellos renqueantes.

—Warran, permítame los mandos del joystick. Déjeme el placer de cargármelas con los láser penetradores.

—Todo suyo comandante.

En la pantalla 3 puntos luminosos zigzagueaban buscando la salida. Tolstar con el disparador en su dedo pulgar sonreía y babeaba. Consiguió encerrar a uno de los objetivos en la diana y ¡bang!. El segundo que más que volar flotaba como un globo, cayó de igual manera.

—Este cabrón me esta vacilando y no consigo alcanzarle. Ya le he disparado seis veces y me esquiva el golpe.

—Mi comandante, si se me permite, yo que usted no me permitiría veleidades. Si nos vuelve a dar podríamos tener problemas. Arraselo con otra granada.

—Sea.

La pantalla del monitor se llenó durante un segundo del fuego amarillo que ya conocían.

—Comandante, siento dar malas noticias pero el ordenador dice que la secuencia del ADN que hemos conseguido pertenece a un animal llamado escarabajo pelotero. Es decir, no tenemos nada.

—Es igual Warran. El jodido de Magadan ya dispondrá a estas alturas de un antídoto viable. No digamos nada para no desmoralizar. Ábrame el fonostron general: “Camaradas de la Pathfinder. ¡Hemos ganado! ¡Hemos jodido bien a esos bichos inmundos! ¡Viva Marte y sus aliados!”

Un grito desabrido se oyó en todos los rincones de la nave. Sin perder un solo segundo, se empezaron a descorchar botellas de todo tipo de vinos y licores: amarillo como el ojo del alcaraván, verde manzana doncella, azul añil, rojo fresa temprana y una suerte de grises marengo.

Unos puñados de arena mas tarde se comenzó a cantar. Primero arias de antiguas operas, mas tarde canciones caribeñas y poco antes del vomito cantos regionales que glosaban la amistad y el amor bajo una pomarada.

Cuando Tolstar despertó se encontró una extremidad marrón nervuda encima de su cabeza. Detrás de ella el resto de un cuerpo tan repulsivo como inquietante.

—Mi querido comandante Tolstar. ¡Qué alegría conocerle! Es usted más interesante aun de lo que imaginé.

La voz de Ct-Nyar llegaba trémula por el efecto del equipo de traducción instalado en el órgano fonador del miorita.

—¿Qué hace usted en mi nave, asqueroso bicharraco?- contestó, desafiante Tolstar.

—Uy, no me parece que se encuentre usted en condiciones de hacer preguntas, mi ebrio comandante, más bien creo por su bien que debe contestar las mías.

—Va listo.

—Bien, suponía que podría haber resistencia. De todos modos le haré una pregunta sencilla: ¿de cuántas naves disponen y donde están?

—Tenemos tres mil quinientas y están todas en su puto culo.

—Vaya. Dispone usted de un vocabulario selecto, comandante. Bien, según antiguas tradiciones de su raza, si no me contesta inmediatamente empezaré a arrojar a los borrachos de su tripulación por la borda. Ct-Zog tráigame a la primera rata que encuentre pero antes límpiela un poco de esa hedionda sustancia que arrojan.

Mur-Alkami entró a trompicones, pálido y ojeroso, con las manos unidas por delante con argollas luminosas.

—Ct-Thep, abra la compuerta de babor.

Una porción de espacio de un color cercano al puré de nabos con pequeñas luciérnagas se abrió a los ojos de un tembloroso Mur-Alkami. Un miorita le empujaba hacia él.

—Esta en sus manos comandante.

—Vayase al cuerno.

—Arrójenlo.

Tolstar alcanzó a ver en el monitor como una sombra flotaba hasta desaparecer.

Fueron cayendo uno tras otro todos los miembros de la tripulación: Rosen, Warran, Salocin al que hubo que arrojar junto a la mesa de bitacora, Chirirommel, Cococohuahua, Viriato y Franco que gritó algo de una legión.

—Bien comandante, ya no nos queda a nadie que arrojar así que pasaremos a la segunda fase del programa que yo llamo Yurumi. Lo aprendí de un viejo libro de su raza sobre costumbres de un antiguo pueblo de una zona denominada Caribe. Funciona porque lo probamos con su querido amigo Sagan y nos cantó sus planes de ataque que nos ayudó a trazar un plan de contraataque, que como puede comprobar ha sido eficaz. Pero vayamos con lo que interesa. Ct-Zog traiga el oso hormiguero y la urna con las hormigas.

Dentro de una jaula un animal negro se revolvía, golpeándose contra los barrotes. Tolstar no podía dejar de mirar a ese vestigio del pasado; un ser largo de casi tres metros, con garras agresivas pensadas para escabar y con un hocico interminable por donde asomaba una lengua untosa repleta de pelos duros y afilados.

—Sí mi querido Tolstar, sé lo que está pensando. Es repulsivo. Pues bien en las entrañas de este planeta aun viven estos seres ciegos y protegidos de la radiación por varias cuartas de tierra. Comen hormigas que siguieron el mismo camino tras el infierno nuclear. Le explico para que sirve. Le vamos a colocar a usted boca abajo y atado por sus cuatro extremidades en cruz. Su esfínter anal quedara por tanto abierto y expuesto a cualquier inclemencia. Como vera Ct-Zog está machacando un millar de hormigas y el zumo que quede se lo introduciremos con suavidad por su compuerta trasera. Notara un picor provocado por el ácido fórmico de la salsa. No se preocupe el oso se encargará de untarla con su delicada lengua.

—Bichos asquerosos, ni se les ocurra…- Una mordaza impidió oír el resto del discurso.

—Comandante, tan pronto como se encuentre con ganas de contestar a mi pregunta levante la cabeza y detendremos el ritual.

Una pasta negra nauseabunda goteaba desde el ano de Tolstar cuando el oso hormiguero liberado de su jaula se precipitó tras ese aroma irresistible. Llevaba ya dos días sin probar bocado y estaba realmente hambriento. Empezó a lengüetear en aquella oquedad angosta y frágil pero no conseguía encontrar hormigas, solo aquella pasta. Alguien tiró de él.

—Me alegro de que sea razonable. Dígame comandante. ¡Quitadle la mordaza!

Tolstar sentía como algo se le desgarraba por dentro y el dolor resultaba insoportable.

—El comandante Magadan y la nave Viking gemela a ésta, se encuentran esperando nuestras noticias en la base del Valle de los Caídos, las coordenadas están en el cuaderno de bitácora. Esta investigando sobre el antídoto para el Luzbel. La nave Mariner la llevaba Sagan cuando perdimos su contacto…

Tolstar perdió el conocimiento. Sangraba abundantemente por la cavidad anal y un color apergaminado cubría su rostro debajo del sudor.

—Soltad al oso hormiguero y que acabe con lo que queda de la rata. Los despojos me los arrojáis por la borda. Ct-Thep tráigame el cuaderno de bitácora que salvamos de la mesa que arrojamos con aquella rata cobarde.

Ct- Nyar dedicó unos minutos al cuaderno mientras observaba complacido como Ct-Thep ayudado por una escoba recogía un amasijo de huesos, sangre y carne de lo que había sido un intrépido marciano traidor.

—Ct-Zog, convoque al estado mayor, creo que tengo el plan de destrucción de las ratas

Los cuatro miembros del estado mayor esperaban nerviosos la llegada del comandante en jefe. De tanto en tanto, escupían restos de raíz de curambo que masticaban para calmar la tensión.

—Señores, dejen de masticar esa droga estúpida y escúchenme con atención.- Gritó Ct-Nyar que, como acostumbraba, apareció súbitamente.

—Como saben tenemos en nuestro poder dos de las tres naves de las ratas. El factor sorpresa, la estupidez de los humanos y la nave que conseguimos camuflar en nuestra base lunar nos han permitido capturarlas. Como también saben nuestro único objetivo es exterminar a la raza humana en el sistema solar. Todavía disponen de otra nave y un contingente técnico-militar en una base en el Valle de los Caídos de coordenadas “@3456543212”. Parece ser que trabajan en la obtención de un antídoto contra el virus que les teletransportamos. Atacaremos con las dos naves humanas para que nos sospechen. La táctica es destruir todo y a todos. Hemos sacrificado a Ct-Chencho y a Ct-Guachimbon y no podemos fallarles. Encomendémonos a Yog-Thulú y a por ellos.- Una sombra verdosa recorrió el semblante de Ct-Nyar cuando el resto del estado mayor jaleó su discurso.

CAPÍTULO XXI

E.Salocín logró incorporarse a pesar de que su malogrado cuerpo hacía lo indecible por permanecer en posición fetal . A su alrededor los vestigios de una selva enferma le recordaban que la tierra un día fue verde, ahora paradójicamente el rojo de su Marte natal había colonizado el planeta azul.

Todavía aturdido por la caída no alcanzaba a recordar lo que acababa de suceder. Imploró a su memoria para que despertara de su letargo, y no paró hasta recorrer los lugares más recónditos de su cabeza. Y allí en los más alto de su conciencia se encontró con el cielo, con el lugar del que había sido expulsado, y así recordó su pasado más reciente arrodillado en el interior de la pathfinder.

Un pelín antes

Mur-Alkami entre sollozos suplicaba piedad a Ct-Thep que se regodeaba de su patetismo arrastrándole entre patadas hacia la esclusa. Que Nemos cediera a las amenazas no era una opción, lo que hacía que solo pudiera salvarse uno y parecía que debía ser el primero en ser lanzado al vacío, después se descubriría el engaño y no habría una segunda oportunidad.

—¡¡¡¡¡Vayase al cuerno!!! -fue lo último que escucho Mur-Alkami antes de comenzar su descenso.

Cuando Ct-Thep se volvió hacia Salocín con ánimos renovados para continuar con la paliza de camino hacia la esclusa, supo que no sería su final. El era un guerrero y no sentía miedo, no cometería el error de su compañero de olvidar que el traje llevaba un paracaídas incorporado.

—¿Lo tiro ya?- se mofaba Ct-Thep, a la vez que daba otro par de leches a Salocín.

Ct-Nyar esperaba a que Nemos comenzara a cantar, pero obviamente el miserable del capitán no abriría la boca, y no por respeto a sus congéneres sino para acallar las bocas de los que habían sido testigos de su traición.

La pezuña de Ct-Thep no paraba de golpear la cabeza de Salocín, quien no pudo reprimir su orgullo, y se giró para clavar sus ojos en la jeta de la lagartija:

—No seré yo el que la palme cabronazo-

Como era de esperar, Ct-Thep no pudo aguantar a que su comandante confirmara la orden y con furia se precipito sobre Salocín, quién aprovechando la inercia se giro sobre si mismo enganchando al Miorita con sus piernas de forma que no fuera una caída en solitario.

Antes de abrir el paracaídas decidió despedirse de su compañero de vuelo, así que cerro el puño dejando el anular tan terso y erguido como su miembro en sus mejores noches de lujuria, y sin privarse de un último gozo grito un claro y sonoro “que te jodan”

Su último recuerdo fue unas nube de fuego que se precipitó sobre su sustento dejándolo de nuevo merced de la gravedad.

[Un pelín después, o lo que es lo mismo en el presente de nuestros personajes que no es el mismo que el nuestro]

Encontró a Ct-Thep, o más bien a lo que quedaba de él a tan solo 100 metros. Tras un rápido vistazo pudo sustraerle la llave magnética que le permitió liberarse de las argollas luminosas que le habían tenido maniatado desde su captura. Con la sensación de sentirse verdaderamente libre continuo con un registro más exhaustivo que le llevo a encontrar entre los restos de una mochila el fonostrón que había sustraído a Mur-Alkami.

Una vez que recuperó las fuerzas, E. Salocín se incorporó e inició un rastreo de la zona para tratar de encontrar algún rastro de la tripulación. Sus esperanzas de encontrar a alguien con vida se desvanecieron rápidamente. “Solo uno tendría la oportunidad de usar el paracaídas” se lamentó junto a los cadáveres desnudos de Franco y Viriato.

Por un instante le flaquearon los ánimos al verse solo en un paraje yermo de vida pero le basto el recuerdo del enjambre de la Pathfinder para cobrar consciencia de que tenía pendiente una comunicación fonostrónica:

—Vadik, me ves, Vadik- repetía compulsivamente impaciente por dar el aviso de alarma

—Sí, sí, te tengo en imagen, ¿que ha sucedido?, no conseguimos ponernos en contacto con la nave

—La hemos cagado, la Pathfinder ha caído en manos mioritas y es más que probable que toda la tripulación haya sido ejecutada. No tenéis mucho tiempo, debéis largaros de la Colonia, es posible que dispongan de toda la información acerca de vuestra localización. Salid ya!! Largaros o veréis caer sobre vuestras cabezas una potencia de fuego positrónico que...................... Vadik, Vadik.... estas ahí. Joder, Joder vaya mierda de fonostrón.

No era posible que todo saliera tan mal, solo en mitad de la nada y sin posibilidad de comunicarse con sus compañeros. Parecía que alguien desde lo más alto tejiera el final de la humanidad sin posibilidad de redención.

Entre la desesperación y la resignación cuando los últimos rayos de luz acariciaban el horizonte, Salocín aun tubo tiempo para esbozar una sonrisa: si el hijoputa que ya había decidido el final de nuestra historia le permitiera una compañía para terminar sus días de marciano en la tierra, que elegiría, una mujer para tratar de perpetuar la especie, o un hombre para follar como locos.

“Sin lugar a dudas me quedaría con la posibilidad de aporcular al que decidió ponerme en esta historia” se consoló con la sensación de ser el último humano sobre la tierra.

 

CAPÍTULO XXII

Vadik se hallaba sumido en una profunda reflexión. Vivía uno de sus momentos zen: su mente trascendía los límites físicos y era capaz de ir más allá de la caverna en la que moraba durante sus horas de vigilia. La técnica para activar esta praxis meditativa se la había enseñado el inapreciable Mur-Alkami. Bien es verdad que este benigno epíteto de “inapreciable” se lo aplicaba ahora que había fallecido, porque de suyo propio, en realidad, no pasaba por ser más que un pelmazo inaguantable. “¡Pobre hombre! ¡qué muerte tan trágica! ¡Era buena persona!”, solía recordar de vez en cuando. Y es que, en el fondo, él tampoco pasaba de ser un flojo sensiblero.

Abrillantar el calzado frotando el cuero hasta que sus destellos resultaban cegadores: así de sencillo era conseguir un estado de consciencia alterada. A partir de ese punto los problemas dejaban de ser tales y las soluciones acudían al galope, luminosas, fulgurantes, disolviendo las tinieblas de su pozo interior. Ya tenía perfectamente delimitado el curso de acción después de los acontecimientos que se habían sucedido. No le quedaba ninguna duda. Su voz subyacente se lo repetía de continuo, se lo gritaba: “Por patas, Vadik, sal por patas y que les den por saco a esta banda de terrestres atorrantes. Además ya tienes el remedio contra el virus, así que lárgate de aquí cagando leches”.

Sin embargo un resto de pundonor, de orgullo, de conciencia del deber le impelía a quedarse en el Valle, y dar la última batalla. Y dudó: “Pero también en Marte tienen derecho a una oportunidad; los mioritas, tarde o temprano, se dirigirán hacia allí. Y lo harán con nuestras naves y las que consigan recuperar de la Luna. Ya disponen de una gracias a la estupidez de Sangar. ¿Por qué no destruyó la Mariner y sus lanzaderas?”

En la actuación de Nemos prefirió no detenerse. Estaba convencido de que se merecía la muerte que había tenido, aunque reconocía la crueldad de la misma. Así pensó: “¡Joder, qué asco! ¡Desde luego los mioritas eran unos auténticos mal nacidos. Y unos maestros en desmoralizar al contrario! ¡Qué poco tardaron los hijos de puta en fonostrar las imágenes de la tortura de Tolstar, con aquella nota a pie de página! ¡Y qué poca dignidad la de aquel jodido traidor!”

Por un momento, se sintió abatido, pero prosiguió con sus elucubraciones. “¡Qué desastre! Y encima sólo se salva el inútil de Salocin. Aquí está, sin más quehacer que hurgar en mi entrepierna. No sé ni para qué nos jugamos la Odín en rescatarlo. Quizá hubiera sido mejor abandonarlo en aquel lugar desolado en el que aterrizó. Aunque debo admitir que el muchachito hace mamadas mucho mejor que Warran… Pobrecito Warran, con lo mono que era y hay que ver cómo quedó de chafado…”

La imagen del rubio efébico Al-Yakhint conjugada con la de la cabeza de Salocin subiendo y bajando sobre su miembro provocaron una súbita contracción de media frecuencia en el músculo pubo-coccígeo de Vadik.

—Bien, Salocin, muy bien. Una fellatio excepcional. Ahora entiendo por qué Warran hablaba tan bien de usted.

—Gracias, comandante. Nací para chupar pollas.

—No se extralimite, Salocin.

—Lo siento, señor. No obstante, señor, permítame decirle que tiene usted un miembro fuera de lo común, señor.

—Lo sé, Salocin, lo sé. Soy consciente de ello –respondió el comandante Magadan mientras sopesaba visualmente sus aludidos genitales.

Vadik se llevó las manos a la cara y suspiró desesperado, implorando a un Dios en el que no creía. ¿Qué iba a hacer con aquella cuadrilla de ineptos? Los mejores habían muerto. Suele ser así, los dioses aman a los valientes y pronto reclaman su compañía. Petrikilo, Yochbús, Gutiérrez de Barnaul y el relamido de Salocin. La escoria del Sistema Solar. La hez de Marte. Lo peorcito de Barnaul. ¡Dios, cómo les odiaba! No era capaz de entender cómo Nemos había conseguido reunir a semejante grupo de ineptos. Sí, la luz de la sabiduría seguía iluminando el camino, aunque ahora pudiera calificarse de estroboscópica. Tenía que deshacerse de aquellas anomalías genéticas con patas. No merecían perpetuarse. Por el bien de la Humanidad, si es que a ésta le quedaba algún futuro todavía.

Vadik empuñó su pistola de positrones con quarks de spin demediado. Apuntó a la cabeza de Salocín, quien andaba ocupado en limpiarse los restos de semen de su rostro.

—¡Salocin! ¡Chúpate esa! –gritó Vadik jubiloso.

Un ligero zumbido. Un leve temblor en la mano de Magadan. Un suave olor a ozono. Y la cabeza de Salocin hinchándose como un glande excitado hasta la explosión final. Así fue.

Mientras se sacudía los restos de vísceras que colgaban de las charreteras de su uniforme, Vadik se encaminó hacia el puente de mando de la Viking. Petrikilo y los demás tenían los minutos contados. No escaparían a su furia homicida y justiciera.

Al verlo entrar en el puente Yochbús se cuadró.

—Señor, justo en este instante estamos estableciendo comunicación con Marte.

Vadik le miró con los ojos inyectados en sangre. Dos segundos después Yochbús o lo que de él quedaba se derrumbó sobre el suelo metálico de la Viking.

Magadan recogió el intercomunicador fonostrónico.

—¡Qué cojones os pasa ahora a vosotros! ¡A ver! –gritó desaforado.

En Barnaul, noventa segundos más tarde, los miembros supervivientes del Consejo de Notables contemplaron el rostro cubierto de sangre y tegumentos de Vadik.

—¿Qué sucede, comandante? –preguntaron alarmados. Hace días que no recibimos noticias desde sus posiciones.

—¿Que qué pasa? –gritó descompuesto Magadan mientras acababa con la vida de Petrikilo, quien en ese momento llegaba al puente a la carrera. ¡Joder!, ¿es que no lo veis? Nos han hecho fosfatina. ¡Malditos mioritas hijos de puta! ¡Ericsson! Vuelvo a Barnaul. Esperadme, no os vayáis.

Cortó la comunicación y miró a su alrededor. Con voz quebrada debido a los gritos que acababa de proferir inició un monocorde canturreo.

—Gutiééééérreeeez, Gutiéééééérreeeeeez de Baaaarnaaaauuuuul, ¿dónde estááááás, bonito? No te escondaaaaaas… Que tengo una cosita para tiiiiiii…

Horas más tarde Vadik regresaba a su camarote con la cabeza de Gutiérrez de Barnaul bajo el brazo. “¡Cuán efímera es la existencia humana!”, reflexionaba. “Somos seres contingentes e insustanciales. En el fondo nada ni nadie tiene sentido y menos que nada, nuestras vidas”.

Contempló el rostro de Gutiérrez de Barnaul descompuesto en una mueca perpetua de pasmo. “Ser o no ser, Gutiérrez, esa es la cuestión. Y yo ya la he respondido: ¡no ser! Es la hora de la masacre y la vorágine”, finalizó su soliloquio con una feroz carcajada.

Mientras tanto la Viking navegaba a través del silencio y el vacío, de vuelta hacia Marte.

 

 
CAPÍTULO XXIII

—“La sangre y la destrucción serán tan comunes y las situaciones pesarosas tan familiares que las madres llegarán a sonreír mientras sostienen los cuerpos de sus hijos, descuartizados por las manos de la guerra”.

—¿Qué dices, Ct-Nyar?, ¿te encuentras bien?.

—¡Claro Tc-Zog! ¿Por qué me haces esa pregunta tan estúpida? Hemos eliminado a todas las ratas de este agujero, tenemos protecciones contra la radiación que nos permitirán despertar a todos nuestros hermanos y extendernos por todo el planeta, conocemos la ubicación de todas las arcas que habían preparado las ratas para su despertar dentro de unos años, hemos recogido códigos genéticos de varias decenas de miles de especies, que nos servirán de alimento y regocijo. ¿Qué importa que Madagan haya escapado?

—Magadán.

—¡Ct-Goz, no me enciendas! En pocos días estaremos en Marte y pasaremos un buen rato aplicándole el Yurumi a esa rata fugitiva, se llame como se llame.

—No sé. Te encuentro cambiado y …

—Ct-Zog vamos a descansar. Estos últimos días han sido bastante movidos y todos estamos un poco nerviosos. Te recomiendo que eleves una plegaria a Yog – Thulú por nuestros hermanos muertos y mañana verás las cosas con más optimismo.

Ct-Zog se retira a su cuarto al paso, meneando la cabeza a los lados y emitiendo ligeras ventosidades amarillentas de preocupación, lo que produce en Ct-Nyar una sensación de culpabilidad muy infrecuente en un miorita.

Quizás Ct-Zog tenga razón. Desde el asunto con aquella rata despreciable. ¿Como se llamaba? …Tolstar, sí. No controlo bien la relación con mis hermanos. Me siento superior, dotado de unas facultades distintas a las propias de mi especie. En fin, puede que recitar los Salmos a Yog – Thulú me devuelva la paz.

De repente, Ct-Nyar se encabrita sobre sus cuartos traseros y golpea los muros de la galería, arrancando guijarros de caliza. Ct-Zog, se ha vuelto hacia su hermano y contempla asombrado la niebla multicolor que le rodea.

¡No! Debiera empezar a escribir una tragedia que ensalzase mi llegada al poder tras haber DESTRUIDO, ELIMINADO, EXTINGUIDO a esa HORRIBLE especie que nos despertó de nuestro letargo místico.

¡Yog – Thulú bendito!¿Qué me pasa?

—¡Ct-Zog! ¡Ayúdame!¡Me encuentro mal!

Silencio. Oscuridad. Carcajadas disléxicas. Inmarcesible y sapientísimo comandante Ct-Nyar. “Deja que vierta mi valor en tus oídos”. ¡Ornella! ¿Dónde estás?

……………………………………………………………………………………………………..

El rumor del separador biológico es atronador. La blancura de la cámara de desinfección va calmando el alma torturada de Ct – Nyar. A ambos lados de su arnés reposan los hermanos heridos en la operación de desratización y, junto a él, Ct- Zog y Ct – Kilo perfuman la habitación a pollo asado en vino blanco durante la mañana del domingo, transpirando cúmulos rosa pálido de alegría.

—Ya vuelve en sí. ¡Alabado sea Yog – Thulú!

—¿Qué me ha pasado?.

—Nada importante: una ligera gripe, aunque muy interesante desde el punto de vista facultativo. ¿No es verdad, Ct – Kilo?.

—Sí, hermano, según me ha explicado Ct – Zog, estuviste muy expuesto a los restos de una rata y seguramente algún pispión o salpicadura te ha contagiado esta enfermedad, que podríamos llamar paranoia vírica.

—Según el análisis celular, está producida por una mutación del raticida luzbelox, que ha modificado su cadena genética por una transformación martensítica, inducida por un compuesto de cobalto que aún no hemos identificado totalmente, pero que suponemos se encontraba en la sangre de los bichos del cuarto planeta. El virus resultante adquiere parte del genoma del huésped y en el momento febril actúa sobre los centros biomagnéticos de las neuronas, exacerbando los comportamientos del individuo.

—Para nosotros no va más allá de un trastorno cerebral, ya que la estructura del cerebelo miorita bloquea todo tipo de tendencia maniaca, aunque, ciertamente, solo hemos podido sanarte con el separador biológico, destruyendo selectivamente cada uno de las colonias víricas por medio de microláser.

—Las ratas, en cambio, sufren todo tipo de irregularidades sicológicas, desde la alteración del sueño o de la conducta sexual hasta las más profundas paranoias; lo que explica toda la serie de bufonadas con las que nos han deleitado esas infelices criaturas, a partir de la llegada de los especímenes marcianos. La enfermedad culmina en un estado de demencia total, puesto que el virus tiene la misma identificación genética que el resto de las células del huesped, con lo que se hace residente en su organismo de por vida.

—Perdona, Ct – Kilo, he creído entender que el virus es incurable, tanto para nosotros como para ellos.

—No, Ct – Nyar, nuestros glóbulos blancos lo reconocen como una célula intrusa, ya que tiene identificadores de gen de rata, y lo destruyen; con alguna dificultad: es cierto, ya que el compuesto de cobalto le otorga una resistencia inusual en este tipo de microorganismos, pero es susceptible de ser tratado con antibióticos. Sin embargo, en el caso de las ratas no produce rechazo, como si fuera una célula más de su cuerpo, por lo que la eliminación por medios químicos o bacteriológicos es imposible, solo el separador biológico puede realizar esa operación y las ratas no disponen de esta tecnología, ¿me equivoco?.

—No, Ct- Kilo. Ni dispondrán de ella, puesto que si lo que dices es cierto y la rata Magadán está infectada, como a todas luces indican sus acciones, la sociedad marciana tiene sus días contados. Debiéramos personarnos allí para disfrutar del espectáculo.

—Me parece una propuesta un poco arriesgada, Ct – Nyar, vista la facilidad con la que se produce el contagio y los síntomas que provoca en nosotros, por que a pesar de lo que dice Ct – Kilo, a mi me produjo una honda preocupación verte en aquél estado deplorable… y las salmodias que recitabas… ¡Puf!.

La ventosidad verde manzana les envolvió en un obsceno ambiente de azahar.

—Tienes razón, Ct – Zog, no te pongas así. Solo estaba bromeando.

—¡Pues aún debes estar convaleciente! ¿No te has dado cuenta que no has expelido ninguna baliza odovisual?

—¡Sí, aún me encuentro un poco débil!

Los tres hermanos expulsaron enormes nimbos de risa negra con olor a perro mojado.

 

 

  

CAPÍTULO XXIV

Se encontraban en la Pathfinder, cuyo interior había sido convenientemente adecuado a las anatomías de los mioritas. Desde la sala de mando observaron cómo la nave interestelar recuperada de la Luna arrasaba los últimos restos de resistencia humana en el Valle.

—¡Un bello espectáculo! ¿No es cierto, hermanos? –exclamó Ct-Nyar.

—Ciertamente. ¡Mirad cómo corren los supervivientes! Son patéticos; creen que tienen alguna esperanza de salvarse –rió Ct-Zog mientras su cuerpo se difuminaba tras una nube de color anaranjado, reflejo de su intensa excitación.

—Ese era el último. Ahora unos torpedos de demolición y podremos pasar al siguiente punto de la agenda –concluyó Ct-Nyar mientras la Cruz que había resistido tantos avatares y siglos de olvido se hundía en la montaña- Bien, hermanos, se nos presentan varias alternativas que debemos debatir a pesar de las premoniciones que respecto a alguna de ellas tiene Ct-Kilo.

Una vez finalizada la fase de exterminio la Pathfinder se sumergió en la panza de la gran nave miorita. Poco después se reunía en la Sala Capitular el Consejo Supremo formado por los anteriores más Ct-Thep y Ct-Latho.

—Compañeros –inició su exposición Ct-Nyar a la par que acompañaba sus palabras con una bruma verdosa reclamando su atención-. Las ratas de la primera Arca han sido eliminadas. La expedición del cuarto planeta ha sido derrotada. Tan sólo la rata Magadan ha conseguido huir con una de las naves. Según nos informa Ct-Kilo, una mutación no esperada del virus raticida con el que les atacamos hace seiscientos ciclos aquí en nuestro mundo y hace poco en el planeta rojo ha hecho enloquecer al comandante y a toda su desaparecida compañía. El virus mutado es muy contagioso, incluso para nosotros, aunque en nuestro caso de una manera no letal. Estimamos que después de la llegada de la rata jefe a su lugar de origen, en un plazo de pocos días toda la población se habrá contagiado y enloquecido con los resultados que son de esperar: masacre y vorágine, como el orate de Magadan repite de continuo por el comunicador de la nave Viking.

Ct-Nyar permaneció en silencio durante unos instantes. Cerró sus ojos amarillos y expelió una ventosidad de color clorofila que se entremezcló con las de sus compañeros. Un aroma a menta y a pantano putrefacto se extendió por la estancia. La victoria y el éxtasis flotaban hacia los conductos de aire acondicionado de la gran nave. Ct-Nyar prosiguió con su exposición.

—La rata Tolstar confesó la situación de las restantes Arcas y sus fechas previstas de apertura...

—Perdón, Ct-Nyar –interrumpió Ct-Latho-, ¿cómo podemos estar seguros de que no nos mintió u ocultó información.

—Querido Ct-Latho, que tus dudas se volatilicen. El Yurumi aplicado a las ratas es infalible: su orificio excretor parece ser altamente sensible. De momento hemos encontrado las catorce Arcas que Tolstar nos señaló. Además estamos barriendo de continuo toda la superficie del planeta con los escáneres positrónicos. Las Arcas detectadas originan un patrón mesomórfico idéntico en las pantallas, así que tenemos un cien por cien de seguridad de que no nos ha engañado, puesto que no hemos encontrado ninguna más aparte de las mencionadas.

Un murmullo de satisfacción en forma de gorjeos surgió de los picos de los miembros del Consejo.

—¡Destruyámosles! –gritó un incontinente Ct-Latho.

—¡Calma, camaradas! Reflexionemos, no nos dejemos avasallar por nuestros sentimientos y el triunfalismo. No nos comportemos como ratas –rió Ct-Nyar coreado por sus adláteres.

—La cosa no es tan sencilla –tomó la palabra Ct-Zog-. Ahora disponemos de la tecnología para fabricar componentes de protección radioactiva. Sin embargo el riesgo para nuestra integridad, a pesar de todo, sigue siendo alto. Dentro de unos mil quinientos años los niveles de radiación serán tolerables para nuestros organismos. Hasta entonces no podremos regresar a la superficie. Para atacar el cuarto planeta deberíamos resucitar a parte de los compañeros durmientes en Shogoth y Azath y, según lo comentado, la subsistencia de todos nuestros nuevos compañeros con los recursos de que disponemos sería difícil. Ya sabéis que el sueño no es aplicable de nuevo a un resucitado.

—¿Cuál es la propuesta entonces? –preguntó Ct-Latho.

—Mantendremos un retén de seguridad. El despertar de las Arcas no será simultáneo, por lo que a medida que surjan del sueño nos encargaremos de enviarles a dormir de nuevo con nuestras armas. Estarán desprevenidos y confiados. Nos hemos hecho con el transmisor del Arca destruida y cuando despierten lo primero que oirán será un cálido saludo de sus antecesores. Después, cuando salgan de la madriguera, llegaremos nosotros. En los próximos trescientos años habremos acabado con todos. Si por causa de algún error quedara alguna más sin descubrir, no tendríamos problemas en detectarla y masacrarles. En verdad estas ratas son unos seres que apetiolan (versión miorita de acojonan). No tuvieron escrúpulo alguno en destruir el planeta para vencernos. No les importó sacrificar a miles de millones de sus congéneres y arrasar la superficie. En fin, nosotros lo hicimos hace sesenta y cinco millones de años, pero fue un accidente. Estos, sin embargo, lo han hecho a conciencia. Parece que es una especie con una locura congénita. No me extraña que el virus haya mutado y hasta él mismo se haya vuelto loco.

—Cognome, Ct-Nyar –confirmó Ct-Latho.- I neto los petiolos que se me esgorcian al noema y me esguencian los glótidos.

—Perdona, Ct-Latho –dijo Ct_Nyar –debes desactivar el traductor simultáneo al idioma de las ratas. No te entendemos.

—Es verdad, qué descuido imperdonable. Disculpad la ofensa, hermanos. Perdonadme por profanar este templo con un lenguaje tan deleznable como el de las ratas.

Un suspiro en forma de nube aromática que recordaba a la leche agria invadió sus cavidades nasales. Ct-Nyar tomó la palabra de nuevo.

—Así, compañeros, sólo nos queda confiar en la acción del virus mutado. También podemos perseguir a la nave fugada y aniquilarla, pero será más divertido colocarnos en la órbita del cuarto planeta y, desde allí, tranquilitos, regocijarnos con su suicidio…

El olor a perro mojado se adueñó una vez más de la sala.

Nave Viking. En algún lugar próximo al cinturón de asteroides.

ANOTACIONES EN LOS CUADERNOS DE VADIK MAGADAN

Es lo único que he podido recuperar del planeta madre después de este desastre: unos cuadernos en los que podré verter mis impresiones y plasmar las pocas esperanzas que nos quedan a los humanos.

He conseguido recuperarme, aunque la debilidad que siento casi me imposibilita cualquier movimiento.

Locura. Así, sin más adjetivos. La locura rapta mi entendimiento y cada vez me cuesta más controlarla. Ahora estoy sereno, pero no sé durante cuanto tiempo. Sólo la ingesta de enormes dosis de cobaltoporfirina consiguen mantenerme cuerdo y equilibrado. Sin embargo la dosis es cada vez mayor y el tiempo de paz más breve. Mi consciencia es como una luz que parpadea y … … … … … … … … … … … … … … … … … … … … … … … …Joder con lo que tengo debajo de los pantalones… Pero ¿qué será será será seráseráserá…? Rezo, y no sé a quien o a qué, para que pueda llegar a Barnaul y estrechar entre mis brazos por última vez a Destra y a mi querida Ingrida. Y alumbrar con un último rescoldo de ilusión el futuro de nuestra colonia. Pero, ¿podré abrazarlas? Tenían razón los genetistas del Arca. Llevamos con nosotros la maldición a la Tierra. Fuimos a buscar respuestas y soluciones para la plaga que nos asolaba sin saber que en el traidor Nemos y en mí mismo anidaba ya el germen del desastre. ¿Cómo podíamos suponer que iba a mutar el virus, a reaccionar en nuestro organismo con la cobaltoporfirina residual y, sencillamente, volvernos locos en vez de matarnos? … … … … … … … … … … … … … … … … … … … … … … .. ¿Cómo iba a saber de estos fantásticos efectos secundarios? ¡Qué pedazo de pollón se me ha puesto! ¡Un culo…! ¡Mi reino por un culo…! Nemos y yo hemos contagiado al resto de la expedición y a los humanos del Arca. Pero ya qué más da: no hay vuelta a atrás. Todos han muerto: unos por mis propias manos, otros por su locura, los más a manos de esos seres infernales. Por fortuna el periodo de incubación del nuevo virus permitió que no infectáramos a los que quedaban en Marte. Al menos ellos mantienen la cordura, si es que en su situación de agonía y desesperación ello es posible. Y el antídoto para el virus original existe, lo tengo aquí, a mi lado: la última oportunidad… … … … … … … … … … … … … … … … … … … … … … Pero… ¡Coño!, si tiene vida propia… Pero, ¡qué curioso segundo efecto secundario…! Oye… Oye… ¿Qué haces? Sí, sí, un culo sí, pero no el mío… Lo que no alcanzo a entender es por qué no han destruido ya la Viking esos hijos de puta mioritas. Aunque puedo imaginarlo: su maldad es tal que preferirán dejar que nos autoaniquilemos, que yo contagie a todos mis compañeros y que lo que ellos no han conseguido con su maldito virus lo logre yo con esta no prevista transformación … … … … … … … … … … … … … … … … … … … … … … ¡Aaagh! ¡Ya te tengo! ¡No, no podrás…! ¡No lo conseguirás! ¡Dios! Apenas consigo dominarla. ¡No! ¡No, hijaputa por detrás no! ¿Quieres destrozarme o qué…? No me cabe duda de que ellos también conocen la mutación y sus efectos. Mi fonostración continua les debe haber convencido de mi locura. Masacre y vorágine. Quién sabe, tal vez estas dos palabras emitidas por todos los canales me proporcionen unos días más de vida. … … … … … … … … … … … … … … … … … … … … … ¡Diosss, cómo dueleeee…! Menos mal que tenía el cuchillo jamonero a mano. ¡Jódete cabrona! ¿Ahora qué, eh? Sí, si retuercete ahí, en el suelo. Agoniza y jódete, que ya no podrás perforarme… ¿Qué te habías pensado? ¡Yo soy el gran Magadan! ¡Magadan el inmortal! Sin polla, pero inmortal… ¡Qué horror! Mis manos teñidas de sangre…¿Llegaré vivo a Marte después de esta mutilación…? Barnaul… Barnaul… Allá voy… ¿Tendrá lugar el ocaso de la raza humana en un escenario tan tétrico…?… … … … … … … … … … … … … … … … … … … … … ¿Aún vives, puta? Nooo, nooo, por la boca no. Nada de mamadasmmmmfff… La luz me abandona… Ingrida, hija mía, escúchame. Huid, huid de Marte… Titán… Quizá no sirva de nada, pero huid… Amartizaré en las cúpulas de Altay… La Viking os esperará…Yo me ocultaré en las ruinas… Radiación, es la única defensa… Un manto de radiación sobre Barnaul y huid… Titán… No os buscarán…Huid…

FIN DE LAS ANOTACIONES

Minas de Barnaul. Marte. Cueva 23 Principal segunda

—¡Madre, madre!

—¡Ingrida! ¿Qué sucede? –preguntó alarmada Destra.

Ingrida Safo recién había regresado de un extraño sueño, tan extraño y visionario como todos los que tenía. La niña se veía a sí misma como Casandra, capaz de ver los acontecimientos futuros y condenada a no ser creída por nadie jamás.

Había soñado con un Vadik, su padre, sereno y reflexivo. Y lo había soñado según lo recordaba de los tiempos felices en la antigua villa bajo las cúpulas de Altay, aplicado en escribir en aquellos incongruentes cuadernos de papel. Por encima de su hombro, ahora como un ectoplasma onírico, Ingrida había leído los últimos pensamientos de su padre. Ofrecían poca esperanza, pero no la oscuridad sin final. Después había atravesado las metálicas paredes de la nave y avanzado a la velocidad de la luz hacia el planeta rojo. Había sobrevolado las oxidadas planicies, las ciudades abandonadas, las cúpulas muertas. Había soñado con un mar azul en Marte, un océano azul que se tornaba rojo y espeso. Había soñado que el agua se volvía sangre y que el mar se encogía hasta convertirse en estanque. De entre el fluido rojo surgía una esfera, una esfera azul sobre la que flotaban los continentes de la Tierra perdida: el centenario talismán de Vadik. La sangre formaba ríos que serpenteaban anárquicos de un lugar del mundo a otro en un baile de muerte, entrelazándose como las vidas de los humanos que habían sido y que ya nunca más hollarían los suelos del planeta azul. Un ser de pesadilla emergía entonces del estanque sanguinolento y con su mano asía la esfera. La observaba con curiosidad, como si fuera una fruta jugosa recién caída del árbol. Ingrida no llegaba a verlo, pero sentía en su alma cómo la esfera desaparecía en las fauces de aquel monstruo. Miles de millones de voces lanzaban un grito de agonía en aquel instante, pleno de horror y desesperación. De repente Ingrida se hallaba de nuevo al lado de su padre mientras éste se asía la cabeza, ensordecido como ella por aquel canto agónico. Despacio, resignado, su padre se ponía en pie, se giraba y sujetaba a Ingrida por los hombros. Con sus ojos fijos en los de la hija se unía al grito abriendo la boca hasta la desmesura, tanto que la niña podía atisbar en el interior de Vadik; allí, en el fondo de la oscura garganta, Ingrida vio de nuevo a su padre, solo, perdido en un desierto rojo e ignoto, infinito, que caminaba con la cabeza gacha, meditabundo. Vadik susurraba: “La locura y la inmortalidad. Ambas son la misma e idéntica cosa. Me aproximo a la segunda huyendo de la primera, pero las distancias se acortan. Dentro de poco seré inmortal y la cordura me habrá abandonado. Si os acercáis a mí poseeréis la locura de un dios. No lo hagáis. No queráis ser dioses. Tomad de mí ahora lo que me resta de humano: compasión y amor. Después, ¡huid! ¡Partid de Barnaul hacia la luminosa eternidad!”

—Padre no está loco. Al menos no del todo. Debemos impedir que el Consejo actúe según se acordó ayer.

—Hija, ¿cómo dices eso? ¿Es que no has oído lo que fonostra desde que partió de la Tierra? Tu pobre padre ha perdido el juicio. Algo espantoso debe haber sucedido allí, algo que le ha trastornado y convertido en una amenaza.

—Pero, madre, trae el antídoto. ¡Sin él estamos perdidos!

—Sí, Ingrida, sin futuro y con la extinción como única alternativa. Pero ya sabes que el Consejo alega que sólo tenemos la palabra de Vadik de que realmente ha encontrado el remedio. Temen alguna clase de traición.

—¡Traición! –escupió con desprecio Ingrida.- Madre, sólo nos queda una salida si queremos sobrevivir como especie: debemos impedir que destruyan la Viking y salvar el antivirus.

—¿Y desobedecer al Consejo? –dudó Destra.

—Sí –afirmó tajante la niña con un centelleo de furia y decisión en los ojos.- Lo haremos aún a costa del enfrentamiento civil. Si es necesario ejecutaremos a los consejeros. Gran parte del Consejo está controlado por la facción de Ornella, la mujer del traidor Tolstar. Tú sabes que la mayor parte de la Colonia nos seguirá.

Destra permaneció durante unos minutos en silencio con la mirada perdida en la bóveda de la caverna, límite y frontera de su mundo actual. Esa mala perra émula de Lady Macbeth era la responsable de la mayor parte de los desastres que les acosaban. Su capacidad de manipulación era asombrosa, había que reconocerlo. Destra estaba convencida de que se había acostado con la mitad más uno de los consejeros. ¡Hasta ese punto era calculadora y mezquina! Ella había impedido que el traidor de su marido fuera ejecutado de inmediato y ahora trataba de evitar que Vadik regresara y explicara toda la verdad. Los informes recibidos eran fragmentarios, pero todo apuntaba hacia una gestión nefasta de las operaciones militares contra aquellos monstruos. ¡Y las imágenes de su tortura! ¡Qué forma de volver a traicionar a los supervivientes! Y aún la muy puta pretendía hacer pasar aquella actitud miserable como la de un héroe. Ingrida estaba en lo cierto, pero no haría falta acabar con la vida de los consejeros. Al menos en un principio. Bastaría con asesinar a la pérfida Ornella. Eso serviría para decantar la opinión del Consejo. Eso y alguna pequeña demostración de fuerza de los seguidores de Magadan. Una sonrisa de triunfo asomó a los labios de Destra. Quedaban apenas unas horas para que la Viking se encontrara al alcance del fuego nuclear de las baterias de Barnaul. La acción debía ser inmediata y contundente.

Madre e hija se abrazaron en lo que tal vez fuera el último episodio de la Historia humana o el primero de un alba de esperanza.

 

 

  

CAPÍTULO XXV

Escribía en sus cuadernos misteriosamente mediatizado, sin noción, a merced de oscuras sombras, con los fantasmas del pasado a las puertas de sí mismo. Había empezado a sentir un zumbido en sus oídos que algo insano habría de anunciar. El sonido, apenas perceptible pero persistente, se inyectaba por sus oídos y llegaba a su cerebro. Pensó en Ulises y las sirenas y aquella parábola que le enseñaron en la Academia Militar de Altay :

“Sin embargo, las sirenas poseen un arma mucho más terrible que el canto: su silencio. No sucedió en realidad, pero es probable que alguien se hubiera salvado alguna vez de sus cantos, aunque nunca de su silencio. Ningún sentimiento terreno puede equipararse a la vanidad de haberlas vencido mediante las propias fuerzas.”

Y después, cuando ya la mente había quedado desazonada por el escueto relato, aquel párrafo final, que rompía el cauce racional y la condenaba a vagar en la perplejidad :

“La tradición añade un comentario a la historia. Se dice que Ulises era tan astuto, tan ladino, que incluso los dioses del destino eran incapaces de penetrar en su fuero interno. Por más que esto sea inconcebible para la mente humana, tal vez Ulises supo del silencio de las sirenas y tan sólo representó tamaña farsa para ellas y para los dioses, en cierta manera a modo de escudo.”

De forma mágica, mediante un chalaneo imposible entre mente y mano diestra - levemente sangrienta por entonces -, Vadik iba transcribiendo al dictado de su mente brumosa ambos textos, de forma lenta e inexorable, en su cuaderno de hojas amarillentas. Sin porqués. El tiempo era como un recuerdo de un pasar lejano en el que él mismo había dejado de ser protagonista y el aire invitaba a esperar, a perseverar en un vacío finito y a la vez interminable. Era casi cierta ya, pues la esperaba inexplicablemente, la embestida de la aceleración de sus neuronas y por ello tenía a mano las ampollas del compuesto cobáltico. Terminó de escribir el texto repasando con agrado la palabra “escudo” varias veces, con parsimonia y de repente surgió el interrogante :

¿Cuál habría de ser mi escudo con estas pocas ansias de perdurar? No quiero continuar pero algo de dentro me hace proseguir. Camino hacia la perdición y sí, es curioso, es la más clara noción que tengo del presente. ¿Destra, Ingrida y esas gentes desesperadas?

En ese momento de esplendor mental, poseyó claramente la noción de, a un lado el Amor, escondido y atrevido a un tiempo, vertido sobre las personas cercanas, y al otro, la Providencia siempre vigilante, ambas sensaciones en conjunción dentro de sí mismo. No había sentido tal clarividencia nunca antes en el pasado porque muy otra hubiera sido su vida : la rivalidad con Nemos; las chiquilladas de juegos entre ratones y gatos más que entre hombre hechos y derechos; las ínfulas ante el prometedor e interminable futuro ... en fin los inservibles movimientos que habían desgarrado las más altas esperanzas de los habitantes de Marte. Repentinamente sintió el calor de la sangre en sus muslos y recordó como en sueños que se había mutilado con atrevimiento su triste atributo sexual. Qué desazón. Aprovechando ese momento de gobierno de su cabeza, fue en busca del equipo médico auxiliar y tras la cauterización del vacío dejado, se creyó a salvo de morir desangrado. Qué triste y poco esperanzador consuelo.

Intentó en vano concentrarse, fonostrar, hacer algo de valía y nada de eso se interpuso en el magma mental salvo el vagar por los corredores de la nave interestelar. El tiempo se traducía en soledad y sombras. La falta de robots y mascotas en los numerosos habitáculos le convertían en el único morador del lugar, de una nave sola en pilotaje automático hacia su hogar natal. Las pertinaces y pausadas sombras, a su paso por los corredores, las escalerillas y los penumbrosos pasillos, eran turbados únicamente por el crepitar metálico de su calzado en el omnipresente suelo de rejilla. La única fe de vida, presente.

La cabeza a punto de estallar, la cabeza a punto de estallar , más lejos, más profundo, en otro plano más lejano y más imperceptible … Vagó mientras comenzaba a sentir un comienzo de caos, de locura; una nueva derrota de su cabeza atenazada lo hizo derrumbarse. Creyó despertar cuerdo otra vez. Se palpó el cuerpo en busca de sangre, o de cualquier indicio sobre el lapso que había pasado fuera de la vigilia. Más sombras y más vacío se le aparecían en trazos mentales como rastro del silencio y la penumbra pues entre ambos acorazaban por dentro el artefacto de navegación espacial, castillo y sepulcro a la vez. Y tras un largo recorrido por los túneles metálicos y oscuros del cuadrante superior de la nao, se aferró a sus cuadernos. Tomó asiento. Sin presión y en una calma libre – un resorte profundo presente en su cabeza - comenzó de nuevo a garabatear a un ritmo rápido como quien hace su testamento al dictado de un ser lejano y desconocido :

Arenas rojas y azules arenas,
Calientes arenas de Barnaul
Decidme dónde mi infancia
Perdí y en qué manos quedó.

Torres firmes inexpugnables,
Torres de Altay y hogar feliz
Que velasteis tantos sueños
De mi ciega pubertad baladí.

Cráteres capillas del espíritu
A vosotros en verdad os exijo
Y a las almas en el pretérito
Por siempre jamás perdidas :

 

... se agarraba a sus frases, a medida que iban surgiendo, claro que de forma desconocida, como quien se agarra a algo familiar que tiene a mano para no ser absorbido por un abismo de destrucción; como quien en su lejana infancia queda atrapado por la visión de una tarde de sol inmortal, con Fobos y Deimos enrojecidos en el cielo, componiendo en las altas cúpulas de Altay un tetragrama de plata, sencillo y acogedor.

¿ Qué de mis vanos desvelos,
Y de mi sed de inmortalidad?
Sextones de oscuros anhelos
¿Mi alma inmortal dónde irá?

Arenas rojas y azules del fin
El postrero instante me llega,
Nace una gran sombra negra
Ninguna luz dorada veo aquí.

Mil senderos que serpentean
Laberínticos para Schiparelli
Entre estas ardientes arenas,
Las rocas y la ausencia de mí ...

 

... las palabras, a un ritmo cada vez más pausado, iban llenando las hojas amarillentas del pasado, del presente y del futuro; el registro de bitácora de la dilatada navegación vital casi a punto de encallar, ora bordeando el caos mental, ora penetrando en un tremendo y preexistente vacío. Un dolor occipital le hizo llevarse las manos a la cabeza ...

... Dios ...Nemos Tolstar ... naves hacia la tierra ... puro y brillante azul de la esfera de cristal ... Destra mía... seres de Barnaul ... cercados en la ciudadela ... esos desconocidos exterminadores ... de la raza humana ... Fobos ... Deimos ... altas torres de Altay ... brillantes torres ... sed de vida ... Ingrida ... profética y dulce ... Epigmenio ... Valle de los caídos ... su alta cruz ... tristes bagatelas en la eternidad ... ah, mi fiel e ingenuo Mur-Alkami ... y tú ... pobre Comandante Magadan ... sed de luz ... necesito más luz ...

La ampolla de colbaltoporfirina no sirvió de nada : quedó desplomado sobre el escritorio mientras el líquido eternizante y aliviador se derramaba sobre el amarillor de la hojas ...

 

CAPITULO XXVI

Una última gota del brebaje omnipotente se precipitó al vacío y su sonido al caer coincidió desesperadamente con otros tres imperceptibles pero necesarios.

Piiit…“ Vadik, ¿estas ahí? ¡Contéstame! Soy Destra. Puedes volver sin miedo. Dominamos el Consejo. No hay peligro. Sucedió tal y como lo soñó Ingrida. Nuestros partidarios controlan Barnaul. Hemos eliminado a Ornella y a aquellos que no te creían. Controlamos las armas del Consejo y las emisoras fonostrópicas. Hemos vencido, Vadik y ha sido por y para ti. Tráenos el antídoto y empecemos otra vez como tú lo soñaste: una raza perfecta, un ser evolucionado sin posibles errores, el ser humano eterno, una vida feliz. ¡Contesta, Vadik! …Mensaje grabado para Vadik Magadan. Mensaje grabado para Vadik Magadan…”

Click… En la pantalla de la Viking un planeta de color sangre estallaba. Una lluvia de rayos amarillos lo habían reventado. A la derecha un puñado de naves en formación construían lo que parecía una sonrisa. Una nube de un gas de color mostaza rodeaba la alegría interestelar.

Crash…De la mesa de bitácora de la Viking cayeron al mismo tiempo e impulsados por la misma voluntad inexplicable, una esfera de vidrio azul que se extinguió en un millón de añicos y un libro de un arcano autor de una isla del océano Atlántico que quedó abierto e inteligente por una página maldita.